Incidental Mutation 'R7675:Naaladl2'
ID 592411
Institutional Source Beutler Lab
Gene Symbol Naaladl2
Ensembl Gene ENSMUSG00000102758
Gene Name N-acetylated alpha-linked acidic dipeptidase-like 2
Synonyms LOC381500, 2810043G22Rik, EG635702
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock # R7675 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 23798102-25144261 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 24551652 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 148 (M148L)
Ref Sequence ENSEMBL: ENSMUSP00000144706 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000203414]
AlphaFold A0A0N4SUJ3
Predicted Effect probably benign
Transcript: ENSMUST00000203414
AA Change: M148L

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000144706
Gene: ENSMUSG00000102758
AA Change: M148L

DomainStartEndE-ValueType
transmembrane domain 120 142 N/A INTRINSIC
Blast:DnaJ 163 212 3e-19 BLAST
PDB:3SJX|A 168 734 2e-52 PDB
SCOP:d1de4c3 415 647 5e-20 SMART
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 97% (28/29)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010109A12Rik T C 5: 93,213,374 S96P unknown Het
5730559C18Rik G T 1: 136,216,003 A565E probably benign Het
Acaca A G 11: 84,315,916 E1534G probably benign Het
Adam7 A T 14: 68,499,853 D773E probably benign Het
C130026I21Rik C T 1: 85,247,015 M266I probably benign Het
Cacna1s T A 1: 136,110,874 I1398N probably damaging Het
Calu C T 6: 29,356,517 T14I probably benign Het
Casp8 A G 1: 58,823,947 D2G possibly damaging Het
Cldn1 T C 16: 26,371,511 N39S probably benign Het
Clspn T C 4: 126,566,320 S447P probably benign Het
Eef2k A G 7: 120,858,504 T29A probably benign Het
Elmsan1 G T 12: 84,173,800 P127T probably damaging Het
Fam205c TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG 4: 42,871,823 probably benign Het
Gm5519 G C 19: 33,825,028 G157A probably benign Het
Gm9844 A T 7: 24,862,359 T28S probably benign Het
Gucy2c A G 6: 136,716,032 V723A possibly damaging Het
Ighv1-69 A T 12: 115,623,589 W3R probably damaging Het
Krtap16-1 A G 11: 99,985,433 C382R possibly damaging Het
Lrrc8a G A 2: 30,255,668 D165N probably damaging Het
Nphp3 A T 9: 104,016,088 E424D probably benign Het
Prpf40a T C 2: 53,145,636 K714R possibly damaging Het
Ptpn23 A T 9: 110,387,026 L1254* probably null Het
Sap30l A G 11: 57,810,041 K174E probably damaging Het
Serpinb9d C T 13: 33,202,776 Q276* probably null Het
Tex14 A G 11: 87,509,678 D432G probably damaging Het
Unc119 G A 11: 78,343,597 G11R probably damaging Het
Usp36 A G 11: 118,263,696 V965A probably benign Het
Vmn2r4 A T 3: 64,415,236 Y21N probably benign Het
Zbtb38 G T 9: 96,685,541 D1163E probably benign Het
Zfp62 A G 11: 49,216,020 I313V possibly damaging Het
Zfp980 C T 4: 145,701,594 Q298* probably null Het
Other mutations in Naaladl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R6043:Naaladl2 UTSW 3 24058214 missense possibly damaging 0.92
R6150:Naaladl2 UTSW 3 24552050 missense probably null 0.19
R6363:Naaladl2 UTSW 3 24335317 missense possibly damaging 0.73
R6738:Naaladl2 UTSW 3 24171642 missense probably benign
R7259:Naaladl2 UTSW 3 24058176 missense possibly damaging 0.69
R7664:Naaladl2 UTSW 3 24058139 missense probably damaging 1.00
R7667:Naaladl2 UTSW 3 24413348 critical splice donor site probably null
R7894:Naaladl2 UTSW 3 23846554 missense possibly damaging 0.62
R8272:Naaladl2 UTSW 3 24058202 missense probably damaging 1.00
R8557:Naaladl2 UTSW 3 24208364 missense probably benign 0.01
R8911:Naaladl2 UTSW 3 23846593 missense probably damaging 1.00
R9098:Naaladl2 UTSW 3 24433180 missense probably benign 0.02
R9193:Naaladl2 UTSW 3 23846578 missense probably damaging 1.00
R9335:Naaladl2 UTSW 3 24413368 missense possibly damaging 0.84
R9339:Naaladl2 UTSW 3 24002982 missense probably damaging 1.00
Z1177:Naaladl2 UTSW 3 23804978 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCATCCAGTTCAGGCTATCTC -3'
(R):5'- GGCACTCTGAGACTTTGGAC -3'

Sequencing Primer
(F):5'- TCCTTAGATTTACTTCCCAGGAAAC -3'
(R):5'- GAGACTTTGGACCTCCATCTTG -3'
Posted On 2019-11-12