Mutagenetix > Incidental Mutations

Incidental Mutation 'R7675:Vmn2r4'

592412

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r4

Ensembl Gene

ENSMUSG00000092049

Gene Name

vomeronasal 2, receptor 4

Synonyms

EG637053

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.064) question?

Stock #

R7675 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

64388621-64415296 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 64415236 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Asparagine at position 21 (Y21N)

Ref Sequence

ENSEMBL: ENSMUSP00000135228 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000175724]

Predicted Effect

probably benign
Transcript: ENSMUST00000175724
AA Change: Y21N

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000135228
Gene: ENSMUSG00000092049
AA Change: Y21N

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:ANF_receptor	88	505	2.3e-75	PFAM
Pfam:NCD3G	547	600	4.7e-17	PFAM
Pfam:7tm_3	633	867	8.2e-47	PFAM

Meta Mutation Damage Score

0.0846

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

97% (28/29)

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010109A12Rik	T	C	5: 93,213,374	S96P	unknown	Het
5730559C18Rik	G	T	1: 136,216,003	A565E	probably benign	Het
Acaca	A	G	11: 84,315,916	E1534G	probably benign	Het
Adam7	A	T	14: 68,499,853	D773E	probably benign	Het
C130026I21Rik	C	T	1: 85,247,015	M266I	probably benign	Het
Cacna1s	T	A	1: 136,110,874	I1398N	probably damaging	Het
Calu	C	T	6: 29,356,517	T14I	probably benign	Het
Casp8	A	G	1: 58,823,947	D2G	possibly damaging	Het
Cldn1	T	C	16: 26,371,511	N39S	probably benign	Het
Clspn	T	C	4: 126,566,320	S447P	probably benign	Het
Eef2k	A	G	7: 120,858,504	T29A	probably benign	Het
Elmsan1	G	T	12: 84,173,800	P127T	probably damaging	Het
Fam205c	TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG	TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG	4: 42,871,823		probably benign	Het
Gm5519	G	C	19: 33,825,028	G157A	probably benign	Het
Gm9844	A	T	7: 24,862,359	T28S	probably benign	Het
Gucy2c	A	G	6: 136,716,032	V723A	possibly damaging	Het
Ighv1-69	A	T	12: 115,623,589	W3R	probably damaging	Het
Krtap16-1	A	G	11: 99,985,433	C382R	possibly damaging	Het
Lrrc8a	G	A	2: 30,255,668	D165N	probably damaging	Het
Naaladl2	T	A	3: 24,551,652	M148L	probably benign	Het
Nphp3	A	T	9: 104,016,088	E424D	probably benign	Het
Prpf40a	T	C	2: 53,145,636	K714R	possibly damaging	Het
Ptpn23	A	T	9: 110,387,026	L1254*	probably null	Het
Sap30l	A	G	11: 57,810,041	K174E	probably damaging	Het
Serpinb9d	C	T	13: 33,202,776	Q276*	probably null	Het
Tex14	A	G	11: 87,509,678	D432G	probably damaging	Het
Unc119	G	A	11: 78,343,597	G11R	probably damaging	Het
Usp36	A	G	11: 118,263,696	V965A	probably benign	Het
Zbtb38	G	T	9: 96,685,541	D1163E	probably benign	Het
Zfp62	A	G	11: 49,216,020	I313V	possibly damaging	Het
Zfp980	C	T	4: 145,701,594	Q298*	probably null	Het

Other mutations in Vmn2r4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01310:Vmn2r4	APN	3	64409779	splice site	probably null
IGL01448:Vmn2r4	APN	3	64406395	missense	probably damaging	0.99
IGL01452:Vmn2r4	APN	3	64406395	missense	probably damaging	0.99
IGL01454:Vmn2r4	APN	3	64406395	missense	probably damaging	0.99
IGL01456:Vmn2r4	APN	3	64406395	missense	probably damaging	0.99
IGL01463:Vmn2r4	APN	3	64406395	missense	probably damaging	0.99
IGL01467:Vmn2r4	APN	3	64406395	missense	probably damaging	0.99
IGL01468:Vmn2r4	APN	3	64406395	missense	probably damaging	0.99
IGL01470:Vmn2r4	APN	3	64406395	missense	probably damaging	0.99
IGL01476:Vmn2r4	APN	3	64406395	missense	probably damaging	0.99
IGL01481:Vmn2r4	APN	3	64406395	missense	probably damaging	0.99
IGL01534:Vmn2r4	APN	3	64406423	missense	probably damaging	1.00
IGL01636:Vmn2r4	APN	3	64406236	missense	probably benign	0.21
IGL01879:Vmn2r4	APN	3	64391010	missense	probably damaging	1.00
IGL02147:Vmn2r4	APN	3	64398361	splice site	probably benign
IGL02276:Vmn2r4	APN	3	64406456	missense	possibly damaging	0.95
IGL02432:Vmn2r4	APN	3	64406400	missense	probably benign	0.38
IGL02533:Vmn2r4	APN	3	64398419	nonsense	probably null
IGL02655:Vmn2r4	APN	3	64398465	missense	probably damaging	0.97
IGL02666:Vmn2r4	APN	3	64389012	missense	probably benign	0.10
IGL02902:Vmn2r4	APN	3	64406916	missense	probably benign	0.22
IGL03189:Vmn2r4	APN	3	64389168	missense	possibly damaging	0.89
IGL03250:Vmn2r4	APN	3	64406642	missense	probably damaging	1.00
IGL03271:Vmn2r4	APN	3	64398429	missense	probably benign	0.01
R0310:Vmn2r4	UTSW	3	64389434	nonsense	probably null
R0504:Vmn2r4	UTSW	3	64389363	missense	probably damaging	1.00
R1546:Vmn2r4	UTSW	3	64406888	missense	probably damaging	1.00
R1562:Vmn2r4	UTSW	3	64389444	missense	probably damaging	0.98
R1863:Vmn2r4	UTSW	3	64406989	missense	probably benign	0.33
R1873:Vmn2r4	UTSW	3	64391058	missense	possibly damaging	0.93
R1939:Vmn2r4	UTSW	3	64398555	missense	probably benign	0.00
R2103:Vmn2r4	UTSW	3	64415283	missense	possibly damaging	0.48
R3083:Vmn2r4	UTSW	3	64389367	missense	probably damaging	1.00
R3687:Vmn2r4	UTSW	3	64389475	missense	possibly damaging	0.93
R3707:Vmn2r4	UTSW	3	64389474	missense	probably damaging	0.99
R3963:Vmn2r4	UTSW	3	64415151	missense	probably damaging	0.99
R4428:Vmn2r4	UTSW	3	64415169	missense	probably damaging	1.00
R4710:Vmn2r4	UTSW	3	64409780	critical splice donor site	probably null
R4737:Vmn2r4	UTSW	3	64409963	missense	probably damaging	1.00
R4767:Vmn2r4	UTSW	3	64390976	missense	probably damaging	0.99
R4776:Vmn2r4	UTSW	3	64388661	missense	probably damaging	0.96
R4834:Vmn2r4	UTSW	3	64410063	missense	probably benign	0.40
R4893:Vmn2r4	UTSW	3	64406255	missense	probably damaging	0.96
R4908:Vmn2r4	UTSW	3	64389055	missense	possibly damaging	0.59
R5049:Vmn2r4	UTSW	3	64398598	splice site	probably null
R5092:Vmn2r4	UTSW	3	64390952	missense	probably benign	0.01
R5234:Vmn2r4	UTSW	3	64398457	missense	possibly damaging	0.88
R5240:Vmn2r4	UTSW	3	64406937	missense	possibly damaging	0.53
R5704:Vmn2r4	UTSW	3	64409949	missense	probably benign	0.03
R5897:Vmn2r4	UTSW	3	64415266	nonsense	probably null
R5907:Vmn2r4	UTSW	3	64391066	missense	probably damaging	0.99
R5924:Vmn2r4	UTSW	3	64389264	missense	probably damaging	1.00
R6145:Vmn2r4	UTSW	3	64406943	missense	probably benign	0.00
R6191:Vmn2r4	UTSW	3	64415281	missense	probably benign	0.34
R6192:Vmn2r4	UTSW	3	64415278	missense	probably benign	0.00
R6207:Vmn2r4	UTSW	3	64406505	missense	probably damaging	1.00
R6457:Vmn2r4	UTSW	3	64409957	missense	probably damaging	1.00
R6533:Vmn2r4	UTSW	3	64415098	missense	probably benign
R6545:Vmn2r4	UTSW	3	64406356	missense	possibly damaging	0.50
R6594:Vmn2r4	UTSW	3	64389310	missense	probably damaging	1.00
R7049:Vmn2r4	UTSW	3	64389129	missense	probably benign	0.14
R7150:Vmn2r4	UTSW	3	64398477	missense	probably benign	0.01
R7187:Vmn2r4	UTSW	3	64415260	missense	probably benign	0.00
R7363:Vmn2r4	UTSW	3	64407011	missense	probably damaging	1.00
R7477:Vmn2r4	UTSW	3	64398429	missense	probably benign	0.01
R7858:Vmn2r4	UTSW	3	64409805	missense	probably benign	0.00
R7888:Vmn2r4	UTSW	3	64406522	missense	probably damaging	0.99
R8678:Vmn2r4	UTSW	3	64406970	missense	probably benign
R8743:Vmn2r4	UTSW	3	64409826	missense	possibly damaging	0.95
X0019:Vmn2r4	UTSW	3	64406636	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- ACTTACCCCTCACACATGGG -3'
(R):5'- TGCATGTGACTGTGACATCTG -3'

Sequencing Primer
(F):5'- GGGTGATTCTATTTCCTCATCAGAG -3'
(R):5'- TTATTTAGTCAAGAGCAGCAAGC -3'

Posted On

2019-11-12