Mutagenetix > Incidental Mutation

Incidental Mutation 'R7675:Clspn'

592414

Institutional Source

Beutler Lab

Gene Symbol

Clspn

Ensembl Gene

ENSMUSG00000042489

Gene Name

claspin

Synonyms

C85083, E130314M08Rik

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7675 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

126556935-126593903 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 126566320 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 447 (S447P)

Ref Sequence

ENSEMBL: ENSMUSP00000045344 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048391] [ENSMUST00000129795]

AlphaFold

Q80YR7

Predicted Effect

probably benign
Transcript: ENSMUST00000048391
AA Change: S447P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000045344
Gene: ENSMUSG00000042489
AA Change: S447P

Domain	Start	End	E-Value	Type
low complexity region	64	75	N/A	INTRINSIC
coiled coil region	159	187	N/A	INTRINSIC
low complexity region	214	230	N/A	INTRINSIC
low complexity region	232	245	N/A	INTRINSIC
low complexity region	477	490	N/A	INTRINSIC
coiled coil region	599	626	N/A	INTRINSIC
low complexity region	632	658	N/A	INTRINSIC
low complexity region	664	681	N/A	INTRINSIC
low complexity region	732	753	N/A	INTRINSIC
low complexity region	793	812	N/A	INTRINSIC
low complexity region	968	975	N/A	INTRINSIC
coiled coil region	1001	1036	N/A	INTRINSIC
low complexity region	1045	1064	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000126512

SMART Domains

Protein: ENSMUSP00000119437
Gene: ENSMUSG00000042489

Domain	Start	End	E-Value	Type
coiled coil region	74	101	N/A	INTRINSIC
low complexity region	108	147	N/A	INTRINSIC
low complexity region	153	170	N/A	INTRINSIC
low complexity region	221	242	N/A	INTRINSIC
low complexity region	282	301	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000129795

SMART Domains

Protein: ENSMUSP00000120683
Gene: ENSMUSG00000042489

Domain	Start	End	E-Value	Type
low complexity region	50	66	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

97% (28/29)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is an essential upstream regulator of checkpoint kinase 1 and triggers a checkpoint arrest of the cell cycle in response to replicative stress or DNA damage. The protein is also required for efficient DNA replication during a normal S phase. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2010]

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010109A12Rik	T	C	5: 93,213,374	S96P	unknown	Het
5730559C18Rik	G	T	1: 136,216,003	A565E	probably benign	Het
Acaca	A	G	11: 84,315,916	E1534G	probably benign	Het
Adam7	A	T	14: 68,499,853	D773E	probably benign	Het
C130026I21Rik	C	T	1: 85,247,015	M266I	probably benign	Het
Cacna1s	T	A	1: 136,110,874	I1398N	probably damaging	Het
Calu	C	T	6: 29,356,517	T14I	probably benign	Het
Casp8	A	G	1: 58,823,947	D2G	possibly damaging	Het
Cldn1	T	C	16: 26,371,511	N39S	probably benign	Het
Eef2k	A	G	7: 120,858,504	T29A	probably benign	Het
Elmsan1	G	T	12: 84,173,800	P127T	probably damaging	Het
Fam205c	TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG	TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG	4: 42,871,823		probably benign	Het
Gm5519	G	C	19: 33,825,028	G157A	probably benign	Het
Gm9844	A	T	7: 24,862,359	T28S	probably benign	Het
Gucy2c	A	G	6: 136,716,032	V723A	possibly damaging	Het
Ighv1-69	A	T	12: 115,623,589	W3R	probably damaging	Het
Krtap16-1	A	G	11: 99,985,433	C382R	possibly damaging	Het
Lrrc8a	G	A	2: 30,255,668	D165N	probably damaging	Het
Naaladl2	T	A	3: 24,551,652	M148L	probably benign	Het
Nphp3	A	T	9: 104,016,088	E424D	probably benign	Het
Prpf40a	T	C	2: 53,145,636	K714R	possibly damaging	Het
Ptpn23	A	T	9: 110,387,026	L1254*	probably null	Het
Sap30l	A	G	11: 57,810,041	K174E	probably damaging	Het
Serpinb9d	C	T	13: 33,202,776	Q276*	probably null	Het
Tex14	A	G	11: 87,509,678	D432G	probably damaging	Het
Unc119	G	A	11: 78,343,597	G11R	probably damaging	Het
Usp36	A	G	11: 118,263,696	V965A	probably benign	Het
Vmn2r4	A	T	3: 64,415,236	Y21N	probably benign	Het
Zbtb38	G	T	9: 96,685,541	D1163E	probably benign	Het
Zfp62	A	G	11: 49,216,020	I313V	possibly damaging	Het
Zfp980	C	T	4: 145,701,594	Q298*	probably null	Het

Other mutations in Clspn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01149:Clspn	APN	4	126573178	missense	probably damaging	1.00
IGL02160:Clspn	APN	4	126581510	missense	probably benign	0.21
IGL02231:Clspn	APN	4	126559228	missense	probably damaging	0.98
IGL02281:Clspn	APN	4	126565770	missense	possibly damaging	0.90
IGL02368:Clspn	APN	4	126566107	missense	probably benign
IGL03149:Clspn	APN	4	126576502	splice site	probably benign
Durch	UTSW	4	126580962	missense	probably damaging	0.99
R0012:Clspn	UTSW	4	126564929	unclassified	probably benign
R0035:Clspn	UTSW	4	126565003	splice site	probably null
R0035:Clspn	UTSW	4	126565003	splice site	probably null
R0207:Clspn	UTSW	4	126590598	missense	possibly damaging	0.82
R0270:Clspn	UTSW	4	126573236	missense	probably damaging	1.00
R0825:Clspn	UTSW	4	126573130	splice site	probably benign
R1082:Clspn	UTSW	4	126577779	missense	possibly damaging	0.95
R1349:Clspn	UTSW	4	126563977	missense	probably benign
R1568:Clspn	UTSW	4	126581517	missense	probably benign	0.01
R1649:Clspn	UTSW	4	126566435	unclassified	probably benign
R1663:Clspn	UTSW	4	126565975	missense	probably benign	0.00
R2497:Clspn	UTSW	4	126572347	missense	possibly damaging	0.79
R3107:Clspn	UTSW	4	126591659	missense	probably benign	0.06
R3951:Clspn	UTSW	4	126576379	missense	probably damaging	1.00
R3953:Clspn	UTSW	4	126566437	frame shift	probably null
R3954:Clspn	UTSW	4	126566437	frame shift	probably null
R3956:Clspn	UTSW	4	126566437	frame shift	probably null
R4599:Clspn	UTSW	4	126581460	missense	probably benign	0.14
R4717:Clspn	UTSW	4	126560056	missense	probably damaging	1.00
R4853:Clspn	UTSW	4	126566555	missense	probably damaging	0.99
R4854:Clspn	UTSW	4	126575950	missense	probably benign
R4979:Clspn	UTSW	4	126578386	missense	probably damaging	1.00
R5363:Clspn	UTSW	4	126561786	missense	possibly damaging	0.58
R5531:Clspn	UTSW	4	126577773	missense	probably benign
R5614:Clspn	UTSW	4	126580962	missense	probably damaging	0.99
R5706:Clspn	UTSW	4	126578418	missense	probably damaging	1.00
R5806:Clspn	UTSW	4	126586106	missense	probably damaging	1.00
R6106:Clspn	UTSW	4	126590641	missense	probably benign	0.00
R6178:Clspn	UTSW	4	126577736	splice site	probably null
R6223:Clspn	UTSW	4	126586168	missense	probably damaging	0.99
R6326:Clspn	UTSW	4	126565739	missense	probably damaging	1.00
R6398:Clspn	UTSW	4	126563947	missense	probably damaging	1.00
R6714:Clspn	UTSW	4	126565768	missense	probably damaging	1.00
R7003:Clspn	UTSW	4	126592720	missense	possibly damaging	0.63
R7034:Clspn	UTSW	4	126580982	missense	possibly damaging	0.87
R7358:Clspn	UTSW	4	126566200	missense	probably benign	0.02
R7376:Clspn	UTSW	4	126590637	missense	possibly damaging	0.65
R8320:Clspn	UTSW	4	126563950	missense	possibly damaging	0.73
R8517:Clspn	UTSW	4	126566219	missense	probably benign	0.00
R8547:Clspn	UTSW	4	126561816	missense	probably damaging	1.00
R9106:Clspn	UTSW	4	126577450	intron	probably benign
R9223:Clspn	UTSW	4	126590618	missense	possibly damaging	0.60
R9361:Clspn	UTSW	4	126585861	missense	probably damaging	0.99
R9527:Clspn	UTSW	4	126559999	nonsense	probably null
R9717:Clspn	UTSW	4	126564963	missense	possibly damaging	0.90
T0975:Clspn	UTSW	4	126566437	unclassified	probably benign
X0014:Clspn	UTSW	4	126575943	missense	probably damaging	1.00
Z1177:Clspn	UTSW	4	126566177	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TCAGAAGAAGCCGGGATCAC -3'
(R):5'- GTTGACTGGAAACATCCACTCCC -3'

Sequencing Primer
(F):5'- TCACTGCTGGATCAGATGAGGC -3'
(R):5'- CAGCTGTCTAAGTCGGTCCAC -3'

Posted On

2019-11-12