Incidental Mutation 'R7675:Zfp980'
ID592415
Institutional Source Beutler Lab
Gene Symbol Zfp980
Ensembl Gene ENSMUSG00000058186
Gene Namezinc finger protein 980
SynonymsGm13242
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.218) question?
Stock #R7675 (G1)
Quality Score191.009
Status Not validated
Chromosome4
Chromosomal Location145670685-145704441 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 145701594 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 298 (Q298*)
Ref Sequence ENSEMBL: ENSMUSP00000101364 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105738] [ENSMUST00000180014]
Predicted Effect probably null
Transcript: ENSMUST00000105738
AA Change: Q298*
SMART Domains Protein: ENSMUSP00000101364
Gene: ENSMUSG00000058186
AA Change: Q298*

DomainStartEndE-ValueType
KRAB 28 90 1.46e-16 SMART
low complexity region 235 246 N/A INTRINSIC
ZnF_C2H2 251 273 1.84e-4 SMART
ZnF_C2H2 279 301 3.49e-5 SMART
ZnF_C2H2 307 329 1.95e-3 SMART
ZnF_C2H2 335 357 5.67e-5 SMART
ZnF_C2H2 363 385 1.98e-4 SMART
ZnF_C2H2 391 413 1.98e-4 SMART
ZnF_C2H2 419 441 2.4e-3 SMART
ZnF_C2H2 447 469 1.22e-4 SMART
ZnF_C2H2 475 497 5.67e-5 SMART
ZnF_C2H2 503 525 1.98e-4 SMART
ZnF_C2H2 531 553 6.88e-4 SMART
ZnF_C2H2 559 581 1.58e-3 SMART
ZnF_C2H2 587 609 1.22e-4 SMART
ZnF_C2H2 615 635 1.26e1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000180014
AA Change: Q298*
SMART Domains Protein: ENSMUSP00000137589
Gene: ENSMUSG00000058186
AA Change: Q298*

DomainStartEndE-ValueType
KRAB 28 90 1.46e-16 SMART
low complexity region 235 246 N/A INTRINSIC
ZnF_C2H2 251 273 1.84e-4 SMART
ZnF_C2H2 279 301 3.49e-5 SMART
ZnF_C2H2 307 329 1.95e-3 SMART
ZnF_C2H2 335 357 5.67e-5 SMART
ZnF_C2H2 363 385 1.98e-4 SMART
ZnF_C2H2 391 413 1.98e-4 SMART
ZnF_C2H2 419 441 2.4e-3 SMART
ZnF_C2H2 447 469 1.22e-4 SMART
ZnF_C2H2 475 497 5.67e-5 SMART
ZnF_C2H2 503 525 1.98e-4 SMART
ZnF_C2H2 531 553 6.88e-4 SMART
ZnF_C2H2 559 581 1.58e-3 SMART
ZnF_C2H2 587 609 1.22e-4 SMART
ZnF_C2H2 615 635 1.26e1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 97% (28/29)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010109A12Rik T C 5: 93,213,374 S96P unknown Het
5730559C18Rik G T 1: 136,216,003 A565E probably benign Het
Acaca A G 11: 84,315,916 E1534G probably benign Het
Adam7 A T 14: 68,499,853 D773E probably benign Het
C130026I21Rik C T 1: 85,247,015 M266I probably benign Het
Cacna1s T A 1: 136,110,874 I1398N probably damaging Het
Calu C T 6: 29,356,517 T14I probably benign Het
Casp8 A G 1: 58,823,947 D2G possibly damaging Het
Cldn1 T C 16: 26,371,511 N39S probably benign Het
Clspn T C 4: 126,566,320 S447P probably benign Het
Eef2k A G 7: 120,858,504 T29A probably benign Het
Elmsan1 G T 12: 84,173,800 P127T probably damaging Het
Fam205c TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG 4: 42,871,823 probably benign Het
Gm5519 G C 19: 33,825,028 G157A probably benign Het
Gm9844 A T 7: 24,862,359 T28S probably benign Het
Gucy2c A G 6: 136,716,032 V723A possibly damaging Het
Ighv1-69 A T 12: 115,623,589 W3R probably damaging Het
Krtap16-1 A G 11: 99,985,433 C382R possibly damaging Het
Lrrc8a G A 2: 30,255,668 D165N probably damaging Het
Naaladl2 T A 3: 24,551,652 M148L probably benign Het
Nphp3 A T 9: 104,016,088 E424D probably benign Het
Prpf40a T C 2: 53,145,636 K714R possibly damaging Het
Ptpn23 A T 9: 110,387,026 L1254* probably null Het
Sap30l A G 11: 57,810,041 K174E probably damaging Het
Serpinb9d C T 13: 33,202,776 Q276* probably null Het
Tex14 A G 11: 87,509,678 D432G probably damaging Het
Unc119 G A 11: 78,343,597 G11R probably damaging Het
Usp36 A G 11: 118,263,696 V965A probably benign Het
Vmn2r4 A T 3: 64,415,236 Y21N probably benign Het
Zbtb38 G T 9: 96,685,541 D1163E probably benign Het
Zfp62 A G 11: 49,216,020 I313V possibly damaging Het
Other mutations in Zfp980
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00828:Zfp980 APN 4 145701991 missense probably benign 0.00
R0164:Zfp980 UTSW 4 145701997 missense probably benign
R0164:Zfp980 UTSW 4 145701997 missense probably benign
R1186:Zfp980 UTSW 4 145702083 missense probably benign
R1761:Zfp980 UTSW 4 145702042 missense probably damaging 1.00
R3726:Zfp980 UTSW 4 145702083 missense probably benign
R4049:Zfp980 UTSW 4 145702600 missense probably damaging 1.00
R4467:Zfp980 UTSW 4 145702083 missense probably benign
R4610:Zfp980 UTSW 4 145702083 missense probably benign
R4622:Zfp980 UTSW 4 145702057 missense probably damaging 1.00
R4873:Zfp980 UTSW 4 145702083 missense probably benign
R5008:Zfp980 UTSW 4 145702083 missense probably benign
R5027:Zfp980 UTSW 4 145702083 missense probably benign
R5497:Zfp980 UTSW 4 145701447 missense probably damaging 1.00
R5995:Zfp980 UTSW 4 145701909 nonsense probably null
R6125:Zfp980 UTSW 4 145702638 makesense probably null
R7353:Zfp980 UTSW 4 145702144 missense probably benign 0.06
R7939:Zfp980 UTSW 4 145702012 missense probably damaging 1.00
R8833:Zfp980 UTSW 4 145701026 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATCAAGGAACCCACATAGAGAAG -3'
(R):5'- TGGTACGGTTTCTCTCCTGT -3'

Sequencing Primer
(F):5'- GTGAAATGAGCACTTACACTTGTGG -3'
(R):5'- CTCCTGTATGAATTCTCTGATGAAC -3'
Posted On2019-11-12