Incidental Mutation 'R7675:Zfp980'
ID 592415
Institutional Source Beutler Lab
Gene Symbol Zfp980
Ensembl Gene ENSMUSG00000058186
Gene Name zinc finger protein 980
Synonyms Gm13242
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.265) question?
Stock # R7675 (G1)
Quality Score 191.009
Status Not validated
Chromosome 4
Chromosomal Location 145670685-145704441 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 145701594 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 298 (Q298*)
Ref Sequence ENSEMBL: ENSMUSP00000101364 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105738] [ENSMUST00000180014]
AlphaFold A2A9J5
Predicted Effect probably null
Transcript: ENSMUST00000105738
AA Change: Q298*
SMART Domains Protein: ENSMUSP00000101364
Gene: ENSMUSG00000058186
AA Change: Q298*

DomainStartEndE-ValueType
KRAB 28 90 1.46e-16 SMART
low complexity region 235 246 N/A INTRINSIC
ZnF_C2H2 251 273 1.84e-4 SMART
ZnF_C2H2 279 301 3.49e-5 SMART
ZnF_C2H2 307 329 1.95e-3 SMART
ZnF_C2H2 335 357 5.67e-5 SMART
ZnF_C2H2 363 385 1.98e-4 SMART
ZnF_C2H2 391 413 1.98e-4 SMART
ZnF_C2H2 419 441 2.4e-3 SMART
ZnF_C2H2 447 469 1.22e-4 SMART
ZnF_C2H2 475 497 5.67e-5 SMART
ZnF_C2H2 503 525 1.98e-4 SMART
ZnF_C2H2 531 553 6.88e-4 SMART
ZnF_C2H2 559 581 1.58e-3 SMART
ZnF_C2H2 587 609 1.22e-4 SMART
ZnF_C2H2 615 635 1.26e1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000180014
AA Change: Q298*
SMART Domains Protein: ENSMUSP00000137589
Gene: ENSMUSG00000058186
AA Change: Q298*

DomainStartEndE-ValueType
KRAB 28 90 1.46e-16 SMART
low complexity region 235 246 N/A INTRINSIC
ZnF_C2H2 251 273 1.84e-4 SMART
ZnF_C2H2 279 301 3.49e-5 SMART
ZnF_C2H2 307 329 1.95e-3 SMART
ZnF_C2H2 335 357 5.67e-5 SMART
ZnF_C2H2 363 385 1.98e-4 SMART
ZnF_C2H2 391 413 1.98e-4 SMART
ZnF_C2H2 419 441 2.4e-3 SMART
ZnF_C2H2 447 469 1.22e-4 SMART
ZnF_C2H2 475 497 5.67e-5 SMART
ZnF_C2H2 503 525 1.98e-4 SMART
ZnF_C2H2 531 553 6.88e-4 SMART
ZnF_C2H2 559 581 1.58e-3 SMART
ZnF_C2H2 587 609 1.22e-4 SMART
ZnF_C2H2 615 635 1.26e1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 97% (28/29)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010109A12Rik T C 5: 93,213,374 S96P unknown Het
5730559C18Rik G T 1: 136,216,003 A565E probably benign Het
Acaca A G 11: 84,315,916 E1534G probably benign Het
Adam7 A T 14: 68,499,853 D773E probably benign Het
C130026I21Rik C T 1: 85,247,015 M266I probably benign Het
Cacna1s T A 1: 136,110,874 I1398N probably damaging Het
Calu C T 6: 29,356,517 T14I probably benign Het
Casp8 A G 1: 58,823,947 D2G possibly damaging Het
Cldn1 T C 16: 26,371,511 N39S probably benign Het
Clspn T C 4: 126,566,320 S447P probably benign Het
Eef2k A G 7: 120,858,504 T29A probably benign Het
Elmsan1 G T 12: 84,173,800 P127T probably damaging Het
Fam205c TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG 4: 42,871,823 probably benign Het
Gm5519 G C 19: 33,825,028 G157A probably benign Het
Gm9844 A T 7: 24,862,359 T28S probably benign Het
Gucy2c A G 6: 136,716,032 V723A possibly damaging Het
Ighv1-69 A T 12: 115,623,589 W3R probably damaging Het
Krtap16-1 A G 11: 99,985,433 C382R possibly damaging Het
Lrrc8a G A 2: 30,255,668 D165N probably damaging Het
Naaladl2 T A 3: 24,551,652 M148L probably benign Het
Nphp3 A T 9: 104,016,088 E424D probably benign Het
Prpf40a T C 2: 53,145,636 K714R possibly damaging Het
Ptpn23 A T 9: 110,387,026 L1254* probably null Het
Sap30l A G 11: 57,810,041 K174E probably damaging Het
Serpinb9d C T 13: 33,202,776 Q276* probably null Het
Tex14 A G 11: 87,509,678 D432G probably damaging Het
Unc119 G A 11: 78,343,597 G11R probably damaging Het
Usp36 A G 11: 118,263,696 V965A probably benign Het
Vmn2r4 A T 3: 64,415,236 Y21N probably benign Het
Zbtb38 G T 9: 96,685,541 D1163E probably benign Het
Zfp62 A G 11: 49,216,020 I313V possibly damaging Het
Other mutations in Zfp980
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00828:Zfp980 APN 4 145701991 missense probably benign 0.00
R0164:Zfp980 UTSW 4 145701997 missense probably benign
R0164:Zfp980 UTSW 4 145701997 missense probably benign
R1186:Zfp980 UTSW 4 145702083 missense probably benign
R1761:Zfp980 UTSW 4 145702042 missense probably damaging 1.00
R3726:Zfp980 UTSW 4 145702083 missense probably benign
R4049:Zfp980 UTSW 4 145702600 missense probably damaging 1.00
R4467:Zfp980 UTSW 4 145702083 missense probably benign
R4610:Zfp980 UTSW 4 145702083 missense probably benign
R4622:Zfp980 UTSW 4 145702057 missense probably damaging 1.00
R4873:Zfp980 UTSW 4 145702083 missense probably benign
R5008:Zfp980 UTSW 4 145702083 missense probably benign
R5027:Zfp980 UTSW 4 145702083 missense probably benign
R5497:Zfp980 UTSW 4 145701447 missense probably damaging 1.00
R5995:Zfp980 UTSW 4 145701909 nonsense probably null
R6125:Zfp980 UTSW 4 145702638 makesense probably null
R7353:Zfp980 UTSW 4 145702144 missense probably benign 0.06
R7939:Zfp980 UTSW 4 145702012 missense probably damaging 1.00
R8833:Zfp980 UTSW 4 145701026 missense probably benign 0.00
R9122:Zfp980 UTSW 4 145702264 missense probably damaging 1.00
R9165:Zfp980 UTSW 4 145701454 missense possibly damaging 0.95
R9361:Zfp980 UTSW 4 145701429 missense probably benign 0.08
R9469:Zfp980 UTSW 4 145701117 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- ATCAAGGAACCCACATAGAGAAG -3'
(R):5'- TGGTACGGTTTCTCTCCTGT -3'

Sequencing Primer
(F):5'- GTGAAATGAGCACTTACACTTGTGG -3'
(R):5'- CTCCTGTATGAATTCTCTGATGAAC -3'
Posted On 2019-11-12