Incidental Mutation 'R7675:2010109A12Rik'
ID 592416
Institutional Source Beutler Lab
Gene Symbol 2010109A12Rik
Ensembl Gene ENSMUSG00000029384
Gene Name RIKEN cDNA 2010109A12 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock # R7675 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 93206518-93213475 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 93213374 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 96 (S96P)
Ref Sequence ENSEMBL: ENSMUSP00000031330 (fasta)
AlphaFold Q9D875
Predicted Effect unknown
Transcript: ENSMUST00000031330
AA Change: S96P
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 97% (28/29)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730559C18Rik G T 1: 136,216,003 A565E probably benign Het
Acaca A G 11: 84,315,916 E1534G probably benign Het
Adam7 A T 14: 68,499,853 D773E probably benign Het
C130026I21Rik C T 1: 85,247,015 M266I probably benign Het
Cacna1s T A 1: 136,110,874 I1398N probably damaging Het
Calu C T 6: 29,356,517 T14I probably benign Het
Casp8 A G 1: 58,823,947 D2G possibly damaging Het
Cldn1 T C 16: 26,371,511 N39S probably benign Het
Clspn T C 4: 126,566,320 S447P probably benign Het
Eef2k A G 7: 120,858,504 T29A probably benign Het
Elmsan1 G T 12: 84,173,800 P127T probably damaging Het
Fam205c TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG 4: 42,871,823 probably benign Het
Gm5519 G C 19: 33,825,028 G157A probably benign Het
Gm9844 A T 7: 24,862,359 T28S probably benign Het
Gucy2c A G 6: 136,716,032 V723A possibly damaging Het
Ighv1-69 A T 12: 115,623,589 W3R probably damaging Het
Krtap16-1 A G 11: 99,985,433 C382R possibly damaging Het
Lrrc8a G A 2: 30,255,668 D165N probably damaging Het
Naaladl2 T A 3: 24,551,652 M148L probably benign Het
Nphp3 A T 9: 104,016,088 E424D probably benign Het
Prpf40a T C 2: 53,145,636 K714R possibly damaging Het
Ptpn23 A T 9: 110,387,026 L1254* probably null Het
Sap30l A G 11: 57,810,041 K174E probably damaging Het
Serpinb9d C T 13: 33,202,776 Q276* probably null Het
Tex14 A G 11: 87,509,678 D432G probably damaging Het
Unc119 G A 11: 78,343,597 G11R probably damaging Het
Usp36 A G 11: 118,263,696 V965A probably benign Het
Vmn2r4 A T 3: 64,415,236 Y21N probably benign Het
Zbtb38 G T 9: 96,685,541 D1163E probably benign Het
Zfp62 A G 11: 49,216,020 I313V possibly damaging Het
Zfp980 C T 4: 145,701,594 Q298* probably null Het
Other mutations in 2010109A12Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R6727:2010109A12Rik UTSW 5 93206575 unclassified probably benign
R7747:2010109A12Rik UTSW 5 93206557 splice site probably null
R9776:2010109A12Rik UTSW 5 93213446 makesense probably null
Predicted Primers PCR Primer
(F):5'- AGCCCTTGCCTAGCACATTG -3'
(R):5'- TGGGAGTAGCTGTGAAACAC -3'

Sequencing Primer
(F):5'- CCCTCAGCATTGAAAACAACTTTATG -3'
(R):5'- CAGTGTGAATCCATTCAGGGATACTC -3'
Posted On 2019-11-12