Mutagenetix > Incidental Mutations

Incidental Mutation 'R7675:Ptpn23'

592423

Institutional Source

Beutler Lab

Gene Symbol

Ptpn23

Ensembl Gene

ENSMUSG00000036057

Gene Name

protein tyrosine phosphatase, non-receptor type 23

Synonyms

PTP-TD14

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7675 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

110385082-110408213 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 110387026 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Stop codon at position 1254 (L1254*)

Ref Sequence

ENSEMBL: ENSMUSP00000039580 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040021] [ENSMUST00000098350]

PDB Structure

MONA SH3C IN COMPLEX [X-RAY DIFFRACTION]

Predicted Effect

probably null
Transcript: ENSMUST00000040021
AA Change: L1254*

SMART Domains

Protein: ENSMUSP00000039580
Gene: ENSMUSG00000036057
AA Change: L1254*

Domain	Start	End	E-Value	Type
BRO1	8	384	5.94e-159	SMART
Pfam:ALIX_LYPXL_bnd	416	704	1.4e-64	PFAM
low complexity region	715	728	N/A	INTRINSIC
low complexity region	774	785	N/A	INTRINSIC
low complexity region	849	858	N/A	INTRINSIC
low complexity region	905	928	N/A	INTRINSIC
internal_repeat_1	929	942	8.2e-5	PROSPERO
internal_repeat_1	943	956	8.2e-5	PROSPERO
low complexity region	977	1018	N/A	INTRINSIC
low complexity region	1040	1061	N/A	INTRINSIC
low complexity region	1088	1106	N/A	INTRINSIC
low complexity region	1128	1160	N/A	INTRINSIC
low complexity region	1185	1200	N/A	INTRINSIC
low complexity region	1225	1235	N/A	INTRINSIC
PTPc	1246	1510	1.28e-92	SMART
low complexity region	1576	1587	N/A	INTRINSIC
low complexity region	1589	1643	N/A	INTRINSIC
Blast:PTPc	1644	1673	9e-8	BLAST
low complexity region	1675	1689	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000098350

SMART Domains

Protein: ENSMUSP00000095953
Gene: ENSMUSG00000032485

Domain	Start	End	E-Value	Type
transmembrane domain	20	42	N/A	INTRINSIC
low complexity region	43	54	N/A	INTRINSIC
low complexity region	153	165	N/A	INTRINSIC
Pfam:Patched	279	504	4.7e-24	PFAM
Pfam:Sterol-sensing	308	459	7.6e-54	PFAM
transmembrane domain	515	534	N/A	INTRINSIC
transmembrane domain	711	733	N/A	INTRINSIC
low complexity region	741	751	N/A	INTRINSIC
WD40	765	802	1.79e-1	SMART
low complexity region	847	865	N/A	INTRINSIC
low complexity region	928	944	N/A	INTRINSIC
WD40	953	990	9.86e1	SMART
low complexity region	1050	1060	N/A	INTRINSIC
WD40	1062	1102	4.18e-2	SMART
WD40	1105	1143	5.64e-8	SMART
WD40	1147	1183	2.4e-1	SMART
WD40	1186	1223	2.56e1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000200531

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

97% (28/29)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the non-receptor type protein-tyrosine phosphatase family. The encoded protein may be involved in the regulation of small nuclear ribonucleo protein assembly and pre-mRNA splicing by modifying the survival motor neuron (SMN) complex. The encoded protein additionally plays a role in ciliogenesis and is part of endosomal sorting complex required for transport (ESCRT) pathways. This gene may serve a tumor suppressor function. [provided by RefSeq, Jul 2016]
PHENOTYPE: Embryos homozygous for a gene trap allele are significantly growth retarded and fail to reach the E8.5 stage. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010109A12Rik	T	C	5: 93,213,374	S96P	unknown	Het
5730559C18Rik	G	T	1: 136,216,003	A565E	probably benign	Het
Acaca	A	G	11: 84,315,916	E1534G	probably benign	Het
Adam7	A	T	14: 68,499,853	D773E	probably benign	Het
C130026I21Rik	C	T	1: 85,247,015	M266I	probably benign	Het
Cacna1s	T	A	1: 136,110,874	I1398N	probably damaging	Het
Calu	C	T	6: 29,356,517	T14I	probably benign	Het
Casp8	A	G	1: 58,823,947	D2G	possibly damaging	Het
Cldn1	T	C	16: 26,371,511	N39S	probably benign	Het
Clspn	T	C	4: 126,566,320	S447P	probably benign	Het
Eef2k	A	G	7: 120,858,504	T29A	probably benign	Het
Elmsan1	G	T	12: 84,173,800	P127T	probably damaging	Het
Fam205c	TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG	TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG	4: 42,871,823		probably benign	Het
Gm5519	G	C	19: 33,825,028	G157A	probably benign	Het
Gm9844	A	T	7: 24,862,359	T28S	probably benign	Het
Gucy2c	A	G	6: 136,716,032	V723A	possibly damaging	Het
Ighv1-69	A	T	12: 115,623,589	W3R	probably damaging	Het
Krtap16-1	A	G	11: 99,985,433	C382R	possibly damaging	Het
Lrrc8a	G	A	2: 30,255,668	D165N	probably damaging	Het
Naaladl2	T	A	3: 24,551,652	M148L	probably benign	Het
Nphp3	A	T	9: 104,016,088	E424D	probably benign	Het
Prpf40a	T	C	2: 53,145,636	K714R	possibly damaging	Het
Sap30l	A	G	11: 57,810,041	K174E	probably damaging	Het
Serpinb9d	C	T	13: 33,202,776	Q276*	probably null	Het
Tex14	A	G	11: 87,509,678	D432G	probably damaging	Het
Unc119	G	A	11: 78,343,597	G11R	probably damaging	Het
Usp36	A	G	11: 118,263,696	V965A	probably benign	Het
Vmn2r4	A	T	3: 64,415,236	Y21N	probably benign	Het
Zbtb38	G	T	9: 96,685,541	D1163E	probably benign	Het
Zfp62	A	G	11: 49,216,020	I313V	possibly damaging	Het
Zfp980	C	T	4: 145,701,594	Q298*	probably null	Het

Other mutations in Ptpn23

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00327:Ptpn23	APN	9	110388106	missense	probably benign	0.00
IGL01462:Ptpn23	APN	9	110408107	missense	probably benign	0.33
IGL01666:Ptpn23	APN	9	110386545	missense	possibly damaging	0.95
IGL01757:Ptpn23	APN	9	110391636	missense	probably damaging	1.00
IGL02402:Ptpn23	APN	9	110393713	missense	possibly damaging	0.81
IGL02891:Ptpn23	APN	9	110388020	nonsense	probably null
peony	UTSW	9	110386507	missense	probably damaging	0.97
FR4449:Ptpn23	UTSW	9	110387633	missense	probably benign	0.15
FR4548:Ptpn23	UTSW	9	110387633	missense	probably benign	0.15
FR4737:Ptpn23	UTSW	9	110387633	missense	probably benign	0.15
FR4976:Ptpn23	UTSW	9	110387633	missense	probably benign	0.15
R0111:Ptpn23	UTSW	9	110385623	missense	probably damaging	0.97
R0377:Ptpn23	UTSW	9	110388132	missense	possibly damaging	0.73
R0432:Ptpn23	UTSW	9	110389010	critical splice donor site	probably null
R0456:Ptpn23	UTSW	9	110389793	splice site	probably null
R0457:Ptpn23	UTSW	9	110386293	missense	possibly damaging	0.95
R0988:Ptpn23	UTSW	9	110388777	missense	probably benign	0.02
R1072:Ptpn23	UTSW	9	110386595	missense	probably benign	0.29
R1769:Ptpn23	UTSW	9	110391678	missense	possibly damaging	0.89
R1859:Ptpn23	UTSW	9	110388870	missense	possibly damaging	0.92
R1891:Ptpn23	UTSW	9	110393800	missense	possibly damaging	0.74
R1915:Ptpn23	UTSW	9	110386507	missense	probably damaging	0.97
R1954:Ptpn23	UTSW	9	110386325	missense	probably damaging	0.99
R2299:Ptpn23	UTSW	9	110392513	missense	possibly damaging	0.72
R2431:Ptpn23	UTSW	9	110386279	nonsense	probably null
R2445:Ptpn23	UTSW	9	110387632	missense	possibly damaging	0.79
R3014:Ptpn23	UTSW	9	110389695	missense	probably benign
R3820:Ptpn23	UTSW	9	110389794	unclassified	probably benign
R3904:Ptpn23	UTSW	9	110389245	missense	probably benign	0.11
R4441:Ptpn23	UTSW	9	110392725	missense	probably benign	0.01
R4464:Ptpn23	UTSW	9	110386813	missense	probably damaging	1.00
R4709:Ptpn23	UTSW	9	110388856	missense	possibly damaging	0.86
R4810:Ptpn23	UTSW	9	110389136	missense	possibly damaging	0.93
R4937:Ptpn23	UTSW	9	110392738	missense	probably benign	0.09
R5023:Ptpn23	UTSW	9	110388556	missense	probably benign	0.00
R5057:Ptpn23	UTSW	9	110388556	missense	probably benign	0.00
R5065:Ptpn23	UTSW	9	110398188	missense	possibly damaging	0.91
R5143:Ptpn23	UTSW	9	110385438	unclassified	probably benign
R5370:Ptpn23	UTSW	9	110385701	missense	possibly damaging	0.79
R5534:Ptpn23	UTSW	9	110392741	missense	possibly damaging	0.95
R5715:Ptpn23	UTSW	9	110387075	missense	probably damaging	1.00
R5914:Ptpn23	UTSW	9	110385443	unclassified	probably benign
R6122:Ptpn23	UTSW	9	110387825	unclassified	probably benign
R6155:Ptpn23	UTSW	9	110387781	unclassified	probably benign
R6156:Ptpn23	UTSW	9	110387781	unclassified	probably benign
R6296:Ptpn23	UTSW	9	110393826	missense	probably damaging	0.96
R6755:Ptpn23	UTSW	9	110389787	missense	probably damaging	0.98
R7018:Ptpn23	UTSW	9	110385816	missense	possibly damaging	0.89
R7126:Ptpn23	UTSW	9	110388744	missense	probably benign	0.00
R7181:Ptpn23	UTSW	9	110385257	missense	unknown
R7578:Ptpn23	UTSW	9	110387608	missense	probably benign	0.33
R7776:Ptpn23	UTSW	9	110386300	missense	possibly damaging	0.89
R7797:Ptpn23	UTSW	9	110393807	missense	possibly damaging	0.86
R8071:Ptpn23	UTSW	9	110388199	missense	probably damaging	0.98
R8071:Ptpn23	UTSW	9	110388200	missense	possibly damaging	0.93
R8954:Ptpn23	UTSW	9	110392500	missense	probably damaging	1.00
X0062:Ptpn23	UTSW	9	110387707	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AGCCAGAAATCTGCAGCTG -3'
(R):5'- TTGCTACAGCCTACCAAGGTAG -3'

Sequencing Primer
(F):5'- CACTAAGGGTGGACAGTATGGC -3'
(R):5'- TACCAAGGTAGATGCAGCTG -3'

Posted On

2019-11-12