Incidental Mutation 'R7675:Ptpn23'
ID592423
Institutional Source Beutler Lab
Gene Symbol Ptpn23
Ensembl Gene ENSMUSG00000036057
Gene Nameprotein tyrosine phosphatase, non-receptor type 23
SynonymsPTP-TD14
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7675 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location110385082-110408213 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 110387026 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 1254 (L1254*)
Ref Sequence ENSEMBL: ENSMUSP00000039580 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040021] [ENSMUST00000098350]
PDB Structure MONA SH3C IN COMPLEX [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000040021
AA Change: L1254*
SMART Domains Protein: ENSMUSP00000039580
Gene: ENSMUSG00000036057
AA Change: L1254*

DomainStartEndE-ValueType
BRO1 8 384 5.94e-159 SMART
Pfam:ALIX_LYPXL_bnd 416 704 1.4e-64 PFAM
low complexity region 715 728 N/A INTRINSIC
low complexity region 774 785 N/A INTRINSIC
low complexity region 849 858 N/A INTRINSIC
low complexity region 905 928 N/A INTRINSIC
internal_repeat_1 929 942 8.2e-5 PROSPERO
internal_repeat_1 943 956 8.2e-5 PROSPERO
low complexity region 977 1018 N/A INTRINSIC
low complexity region 1040 1061 N/A INTRINSIC
low complexity region 1088 1106 N/A INTRINSIC
low complexity region 1128 1160 N/A INTRINSIC
low complexity region 1185 1200 N/A INTRINSIC
low complexity region 1225 1235 N/A INTRINSIC
PTPc 1246 1510 1.28e-92 SMART
low complexity region 1576 1587 N/A INTRINSIC
low complexity region 1589 1643 N/A INTRINSIC
Blast:PTPc 1644 1673 9e-8 BLAST
low complexity region 1675 1689 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098350
SMART Domains Protein: ENSMUSP00000095953
Gene: ENSMUSG00000032485

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
low complexity region 43 54 N/A INTRINSIC
low complexity region 153 165 N/A INTRINSIC
Pfam:Patched 279 504 4.7e-24 PFAM
Pfam:Sterol-sensing 308 459 7.6e-54 PFAM
transmembrane domain 515 534 N/A INTRINSIC
transmembrane domain 711 733 N/A INTRINSIC
low complexity region 741 751 N/A INTRINSIC
WD40 765 802 1.79e-1 SMART
low complexity region 847 865 N/A INTRINSIC
low complexity region 928 944 N/A INTRINSIC
WD40 953 990 9.86e1 SMART
low complexity region 1050 1060 N/A INTRINSIC
WD40 1062 1102 4.18e-2 SMART
WD40 1105 1143 5.64e-8 SMART
WD40 1147 1183 2.4e-1 SMART
WD40 1186 1223 2.56e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200531
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 97% (28/29)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the non-receptor type protein-tyrosine phosphatase family. The encoded protein may be involved in the regulation of small nuclear ribonucleo protein assembly and pre-mRNA splicing by modifying the survival motor neuron (SMN) complex. The encoded protein additionally plays a role in ciliogenesis and is part of endosomal sorting complex required for transport (ESCRT) pathways. This gene may serve a tumor suppressor function. [provided by RefSeq, Jul 2016]
PHENOTYPE: Embryos homozygous for a gene trap allele are significantly growth retarded and fail to reach the E8.5 stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010109A12Rik T C 5: 93,213,374 S96P unknown Het
5730559C18Rik G T 1: 136,216,003 A565E probably benign Het
Acaca A G 11: 84,315,916 E1534G probably benign Het
Adam7 A T 14: 68,499,853 D773E probably benign Het
C130026I21Rik C T 1: 85,247,015 M266I probably benign Het
Cacna1s T A 1: 136,110,874 I1398N probably damaging Het
Calu C T 6: 29,356,517 T14I probably benign Het
Casp8 A G 1: 58,823,947 D2G possibly damaging Het
Cldn1 T C 16: 26,371,511 N39S probably benign Het
Clspn T C 4: 126,566,320 S447P probably benign Het
Eef2k A G 7: 120,858,504 T29A probably benign Het
Elmsan1 G T 12: 84,173,800 P127T probably damaging Het
Fam205c TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG 4: 42,871,823 probably benign Het
Gm5519 G C 19: 33,825,028 G157A probably benign Het
Gm9844 A T 7: 24,862,359 T28S probably benign Het
Gucy2c A G 6: 136,716,032 V723A possibly damaging Het
Ighv1-69 A T 12: 115,623,589 W3R probably damaging Het
Krtap16-1 A G 11: 99,985,433 C382R possibly damaging Het
Lrrc8a G A 2: 30,255,668 D165N probably damaging Het
Naaladl2 T A 3: 24,551,652 M148L probably benign Het
Nphp3 A T 9: 104,016,088 E424D probably benign Het
Prpf40a T C 2: 53,145,636 K714R possibly damaging Het
Sap30l A G 11: 57,810,041 K174E probably damaging Het
Serpinb9d C T 13: 33,202,776 Q276* probably null Het
Tex14 A G 11: 87,509,678 D432G probably damaging Het
Unc119 G A 11: 78,343,597 G11R probably damaging Het
Usp36 A G 11: 118,263,696 V965A probably benign Het
Vmn2r4 A T 3: 64,415,236 Y21N probably benign Het
Zbtb38 G T 9: 96,685,541 D1163E probably benign Het
Zfp62 A G 11: 49,216,020 I313V possibly damaging Het
Zfp980 C T 4: 145,701,594 Q298* probably null Het
Other mutations in Ptpn23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Ptpn23 APN 9 110388106 missense probably benign 0.00
IGL01462:Ptpn23 APN 9 110408107 missense probably benign 0.33
IGL01666:Ptpn23 APN 9 110386545 missense possibly damaging 0.95
IGL01757:Ptpn23 APN 9 110391636 missense probably damaging 1.00
IGL02402:Ptpn23 APN 9 110393713 missense possibly damaging 0.81
IGL02891:Ptpn23 APN 9 110388020 nonsense probably null
peony UTSW 9 110386507 missense probably damaging 0.97
FR4449:Ptpn23 UTSW 9 110387633 missense probably benign 0.15
FR4548:Ptpn23 UTSW 9 110387633 missense probably benign 0.15
FR4737:Ptpn23 UTSW 9 110387633 missense probably benign 0.15
FR4976:Ptpn23 UTSW 9 110387633 missense probably benign 0.15
R0111:Ptpn23 UTSW 9 110385623 missense probably damaging 0.97
R0377:Ptpn23 UTSW 9 110388132 missense possibly damaging 0.73
R0432:Ptpn23 UTSW 9 110389010 critical splice donor site probably null
R0456:Ptpn23 UTSW 9 110389793 splice site probably null
R0457:Ptpn23 UTSW 9 110386293 missense possibly damaging 0.95
R0988:Ptpn23 UTSW 9 110388777 missense probably benign 0.02
R1072:Ptpn23 UTSW 9 110386595 missense probably benign 0.29
R1769:Ptpn23 UTSW 9 110391678 missense possibly damaging 0.89
R1859:Ptpn23 UTSW 9 110388870 missense possibly damaging 0.92
R1891:Ptpn23 UTSW 9 110393800 missense possibly damaging 0.74
R1915:Ptpn23 UTSW 9 110386507 missense probably damaging 0.97
R1954:Ptpn23 UTSW 9 110386325 missense probably damaging 0.99
R2299:Ptpn23 UTSW 9 110392513 missense possibly damaging 0.72
R2431:Ptpn23 UTSW 9 110386279 nonsense probably null
R2445:Ptpn23 UTSW 9 110387632 missense possibly damaging 0.79
R3014:Ptpn23 UTSW 9 110389695 missense probably benign
R3820:Ptpn23 UTSW 9 110389794 unclassified probably benign
R3904:Ptpn23 UTSW 9 110389245 missense probably benign 0.11
R4441:Ptpn23 UTSW 9 110392725 missense probably benign 0.01
R4464:Ptpn23 UTSW 9 110386813 missense probably damaging 1.00
R4709:Ptpn23 UTSW 9 110388856 missense possibly damaging 0.86
R4810:Ptpn23 UTSW 9 110389136 missense possibly damaging 0.93
R4937:Ptpn23 UTSW 9 110392738 missense probably benign 0.09
R5023:Ptpn23 UTSW 9 110388556 missense probably benign 0.00
R5057:Ptpn23 UTSW 9 110388556 missense probably benign 0.00
R5065:Ptpn23 UTSW 9 110398188 missense possibly damaging 0.91
R5143:Ptpn23 UTSW 9 110385438 unclassified probably benign
R5370:Ptpn23 UTSW 9 110385701 missense possibly damaging 0.79
R5534:Ptpn23 UTSW 9 110392741 missense possibly damaging 0.95
R5715:Ptpn23 UTSW 9 110387075 missense probably damaging 1.00
R5914:Ptpn23 UTSW 9 110385443 unclassified probably benign
R6122:Ptpn23 UTSW 9 110387825 unclassified probably benign
R6155:Ptpn23 UTSW 9 110387781 unclassified probably benign
R6156:Ptpn23 UTSW 9 110387781 unclassified probably benign
R6296:Ptpn23 UTSW 9 110393826 missense probably damaging 0.96
R6755:Ptpn23 UTSW 9 110389787 missense probably damaging 0.98
R7018:Ptpn23 UTSW 9 110385816 missense possibly damaging 0.89
R7126:Ptpn23 UTSW 9 110388744 missense probably benign 0.00
R7181:Ptpn23 UTSW 9 110385257 missense unknown
R7578:Ptpn23 UTSW 9 110387608 missense probably benign 0.33
R7776:Ptpn23 UTSW 9 110386300 missense possibly damaging 0.89
R7797:Ptpn23 UTSW 9 110393807 missense possibly damaging 0.86
R8071:Ptpn23 UTSW 9 110388199 missense probably damaging 0.98
R8071:Ptpn23 UTSW 9 110388200 missense possibly damaging 0.93
R8954:Ptpn23 UTSW 9 110392500 missense probably damaging 1.00
X0062:Ptpn23 UTSW 9 110387707 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCCAGAAATCTGCAGCTG -3'
(R):5'- TTGCTACAGCCTACCAAGGTAG -3'

Sequencing Primer
(F):5'- CACTAAGGGTGGACAGTATGGC -3'
(R):5'- TACCAAGGTAGATGCAGCTG -3'
Posted On2019-11-12