Incidental Mutation 'R7675:Zfp62'
ID592424
Institutional Source Beutler Lab
Gene Symbol Zfp62
Ensembl Gene ENSMUSG00000046311
Gene Namezinc finger protein 62
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R7675 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location49203292-49218816 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 49216020 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 313 (I313V)
Ref Sequence ENSEMBL: ENSMUSP00000056226 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061757] [ENSMUST00000109197] [ENSMUST00000109198] [ENSMUST00000133150] [ENSMUST00000136539] [ENSMUST00000136691] [ENSMUST00000137061] [ENSMUST00000150284] [ENSMUST00000151228] [ENSMUST00000180016]
Predicted Effect possibly damaging
Transcript: ENSMUST00000061757
AA Change: I313V

PolyPhen 2 Score 0.755 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000056226
Gene: ENSMUSG00000046311
AA Change: I313V

DomainStartEndE-ValueType
ZnF_C2H2 124 146 7.26e-3 SMART
ZnF_C2H2 152 174 7.26e-3 SMART
ZnF_C2H2 180 202 2.75e-3 SMART
ZnF_C2H2 208 230 2.71e-2 SMART
ZnF_C2H2 236 258 7.37e-4 SMART
ZnF_C2H2 264 286 2.27e-4 SMART
ZnF_C2H2 292 314 4.11e-2 SMART
ZnF_C2H2 320 342 1.03e-2 SMART
ZnF_C2H2 348 370 4.54e-4 SMART
ZnF_C2H2 376 398 4.47e-3 SMART
ZnF_C2H2 404 426 4.4e-2 SMART
ZnF_C2H2 432 454 2.43e-4 SMART
ZnF_C2H2 460 482 1.38e-3 SMART
ZnF_C2H2 488 510 2.79e-4 SMART
ZnF_C2H2 516 538 5.9e-3 SMART
ZnF_C2H2 544 566 3.39e-3 SMART
ZnF_C2H2 572 594 3.89e-3 SMART
ZnF_C2H2 600 622 5.5e-3 SMART
ZnF_C2H2 628 650 2.75e-3 SMART
ZnF_C2H2 656 678 3.63e-3 SMART
ZnF_C2H2 684 706 7.9e-4 SMART
ZnF_C2H2 712 734 8.34e-3 SMART
ZnF_C2H2 740 762 1.98e-4 SMART
ZnF_C2H2 768 790 1.53e-1 SMART
ZnF_C2H2 796 817 1.16e1 SMART
ZnF_C2H2 823 845 5.99e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000109197
AA Change: I313V

PolyPhen 2 Score 0.755 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000104820
Gene: ENSMUSG00000046311
AA Change: I313V

DomainStartEndE-ValueType
ZnF_C2H2 124 146 7.26e-3 SMART
ZnF_C2H2 152 174 7.26e-3 SMART
ZnF_C2H2 180 202 2.75e-3 SMART
ZnF_C2H2 208 230 2.71e-2 SMART
ZnF_C2H2 236 258 7.37e-4 SMART
ZnF_C2H2 264 286 2.27e-4 SMART
ZnF_C2H2 292 314 4.11e-2 SMART
ZnF_C2H2 320 342 1.03e-2 SMART
ZnF_C2H2 348 370 4.54e-4 SMART
ZnF_C2H2 376 398 4.47e-3 SMART
ZnF_C2H2 404 426 4.4e-2 SMART
ZnF_C2H2 432 454 2.43e-4 SMART
ZnF_C2H2 460 482 1.38e-3 SMART
ZnF_C2H2 488 510 2.79e-4 SMART
ZnF_C2H2 516 538 5.9e-3 SMART
ZnF_C2H2 544 566 3.39e-3 SMART
ZnF_C2H2 572 594 3.89e-3 SMART
ZnF_C2H2 600 622 5.5e-3 SMART
ZnF_C2H2 628 650 2.75e-3 SMART
ZnF_C2H2 656 678 3.63e-3 SMART
ZnF_C2H2 684 706 7.9e-4 SMART
ZnF_C2H2 712 734 8.34e-3 SMART
ZnF_C2H2 740 762 1.98e-4 SMART
ZnF_C2H2 768 790 1.53e-1 SMART
ZnF_C2H2 796 817 1.16e1 SMART
ZnF_C2H2 823 845 5.99e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000109198
AA Change: I313V

PolyPhen 2 Score 0.755 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000104821
Gene: ENSMUSG00000046311
AA Change: I313V

DomainStartEndE-ValueType
ZnF_C2H2 124 146 7.26e-3 SMART
ZnF_C2H2 152 174 7.26e-3 SMART
ZnF_C2H2 180 202 2.75e-3 SMART
ZnF_C2H2 208 230 2.71e-2 SMART
ZnF_C2H2 236 258 7.37e-4 SMART
ZnF_C2H2 264 286 2.27e-4 SMART
ZnF_C2H2 292 314 4.11e-2 SMART
ZnF_C2H2 320 342 1.03e-2 SMART
ZnF_C2H2 348 370 4.54e-4 SMART
ZnF_C2H2 376 398 4.47e-3 SMART
ZnF_C2H2 404 426 4.4e-2 SMART
ZnF_C2H2 432 454 2.43e-4 SMART
ZnF_C2H2 460 482 1.38e-3 SMART
ZnF_C2H2 488 510 2.79e-4 SMART
ZnF_C2H2 516 538 5.9e-3 SMART
ZnF_C2H2 544 566 3.39e-3 SMART
ZnF_C2H2 572 594 3.89e-3 SMART
ZnF_C2H2 600 622 5.5e-3 SMART
ZnF_C2H2 628 650 2.75e-3 SMART
ZnF_C2H2 656 678 3.63e-3 SMART
ZnF_C2H2 684 706 7.9e-4 SMART
ZnF_C2H2 712 734 8.34e-3 SMART
ZnF_C2H2 740 762 1.98e-4 SMART
ZnF_C2H2 768 790 1.53e-1 SMART
ZnF_C2H2 796 817 1.16e1 SMART
ZnF_C2H2 823 845 5.99e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133150
Predicted Effect possibly damaging
Transcript: ENSMUST00000136539
AA Change: I313V

PolyPhen 2 Score 0.755 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000116045
Gene: ENSMUSG00000046311
AA Change: I313V

DomainStartEndE-ValueType
ZnF_C2H2 124 146 7.26e-3 SMART
ZnF_C2H2 152 174 7.26e-3 SMART
ZnF_C2H2 180 202 2.75e-3 SMART
ZnF_C2H2 208 230 2.71e-2 SMART
ZnF_C2H2 236 258 7.37e-4 SMART
ZnF_C2H2 264 286 2.27e-4 SMART
ZnF_C2H2 292 314 4.11e-2 SMART
ZnF_C2H2 320 342 1.03e-2 SMART
ZnF_C2H2 348 370 4.54e-4 SMART
ZnF_C2H2 376 398 4.47e-3 SMART
ZnF_C2H2 404 426 4.4e-2 SMART
ZnF_C2H2 432 454 2.43e-4 SMART
ZnF_C2H2 460 482 1.38e-3 SMART
ZnF_C2H2 488 510 2.79e-4 SMART
ZnF_C2H2 516 538 5.9e-3 SMART
ZnF_C2H2 544 566 3.39e-3 SMART
ZnF_C2H2 572 594 3.89e-3 SMART
ZnF_C2H2 600 622 5.5e-3 SMART
ZnF_C2H2 628 650 2.75e-3 SMART
ZnF_C2H2 656 678 3.63e-3 SMART
ZnF_C2H2 684 706 7.9e-4 SMART
ZnF_C2H2 712 734 8.34e-3 SMART
ZnF_C2H2 740 762 1.98e-4 SMART
ZnF_C2H2 768 790 1.53e-1 SMART
ZnF_C2H2 796 817 1.16e1 SMART
ZnF_C2H2 823 845 5.99e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136691
Predicted Effect probably benign
Transcript: ENSMUST00000137061
Predicted Effect probably benign
Transcript: ENSMUST00000150284
Predicted Effect probably benign
Transcript: ENSMUST00000151228
SMART Domains Protein: ENSMUSP00000117774
Gene: ENSMUSG00000046311

DomainStartEndE-ValueType
ZnF_C2H2 124 146 7.26e-3 SMART
ZnF_C2H2 152 174 7.26e-3 SMART
Pfam:zf-C2H2_6 179 195 2.3e-3 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000180016
AA Change: I313V

PolyPhen 2 Score 0.755 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000137583
Gene: ENSMUSG00000046311
AA Change: I313V

DomainStartEndE-ValueType
ZnF_C2H2 124 146 7.26e-3 SMART
ZnF_C2H2 152 174 7.26e-3 SMART
ZnF_C2H2 180 202 2.75e-3 SMART
ZnF_C2H2 208 230 2.71e-2 SMART
ZnF_C2H2 236 258 7.37e-4 SMART
ZnF_C2H2 264 286 2.27e-4 SMART
ZnF_C2H2 292 314 4.11e-2 SMART
ZnF_C2H2 320 342 1.03e-2 SMART
ZnF_C2H2 348 370 4.54e-4 SMART
ZnF_C2H2 376 398 4.47e-3 SMART
ZnF_C2H2 404 426 4.4e-2 SMART
ZnF_C2H2 432 454 2.43e-4 SMART
ZnF_C2H2 460 482 1.38e-3 SMART
ZnF_C2H2 488 510 2.79e-4 SMART
ZnF_C2H2 516 538 5.9e-3 SMART
ZnF_C2H2 544 566 3.39e-3 SMART
ZnF_C2H2 572 594 3.89e-3 SMART
ZnF_C2H2 600 622 5.5e-3 SMART
ZnF_C2H2 628 650 2.75e-3 SMART
ZnF_C2H2 656 678 3.63e-3 SMART
ZnF_C2H2 684 706 7.9e-4 SMART
ZnF_C2H2 712 734 8.34e-3 SMART
ZnF_C2H2 740 762 1.98e-4 SMART
ZnF_C2H2 768 790 1.53e-1 SMART
ZnF_C2H2 796 817 1.16e1 SMART
ZnF_C2H2 823 845 5.99e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 97% (28/29)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010109A12Rik T C 5: 93,213,374 S96P unknown Het
5730559C18Rik G T 1: 136,216,003 A565E probably benign Het
Acaca A G 11: 84,315,916 E1534G probably benign Het
Adam7 A T 14: 68,499,853 D773E probably benign Het
C130026I21Rik C T 1: 85,247,015 M266I probably benign Het
Cacna1s T A 1: 136,110,874 I1398N probably damaging Het
Calu C T 6: 29,356,517 T14I probably benign Het
Casp8 A G 1: 58,823,947 D2G possibly damaging Het
Cldn1 T C 16: 26,371,511 N39S probably benign Het
Clspn T C 4: 126,566,320 S447P probably benign Het
Eef2k A G 7: 120,858,504 T29A probably benign Het
Elmsan1 G T 12: 84,173,800 P127T probably damaging Het
Fam205c TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG 4: 42,871,823 probably benign Het
Gm5519 G C 19: 33,825,028 G157A probably benign Het
Gm9844 A T 7: 24,862,359 T28S probably benign Het
Gucy2c A G 6: 136,716,032 V723A possibly damaging Het
Ighv1-69 A T 12: 115,623,589 W3R probably damaging Het
Krtap16-1 A G 11: 99,985,433 C382R possibly damaging Het
Lrrc8a G A 2: 30,255,668 D165N probably damaging Het
Naaladl2 T A 3: 24,551,652 M148L probably benign Het
Nphp3 A T 9: 104,016,088 E424D probably benign Het
Prpf40a T C 2: 53,145,636 K714R possibly damaging Het
Ptpn23 A T 9: 110,387,026 L1254* probably null Het
Sap30l A G 11: 57,810,041 K174E probably damaging Het
Serpinb9d C T 13: 33,202,776 Q276* probably null Het
Tex14 A G 11: 87,509,678 D432G probably damaging Het
Unc119 G A 11: 78,343,597 G11R probably damaging Het
Usp36 A G 11: 118,263,696 V965A probably benign Het
Vmn2r4 A T 3: 64,415,236 Y21N probably benign Het
Zbtb38 G T 9: 96,685,541 D1163E probably benign Het
Zfp980 C T 4: 145,701,594 Q298* probably null Het
Other mutations in Zfp62
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03342:Zfp62 APN 11 49215471 nonsense probably null
R0416:Zfp62 UTSW 11 49215676 missense probably damaging 1.00
R0540:Zfp62 UTSW 11 49215400 missense probably benign
R0607:Zfp62 UTSW 11 49215400 missense probably benign
R1119:Zfp62 UTSW 11 49216690 missense probably damaging 0.99
R1230:Zfp62 UTSW 11 49215099 missense probably damaging 0.96
R1644:Zfp62 UTSW 11 49215769 missense probably damaging 0.99
R1710:Zfp62 UTSW 11 49217683 missense probably benign
R1840:Zfp62 UTSW 11 49216388 missense probably damaging 1.00
R1908:Zfp62 UTSW 11 49216220 missense probably damaging 0.99
R3878:Zfp62 UTSW 11 49215133 missense probably damaging 0.99
R4571:Zfp62 UTSW 11 49215741 missense probably damaging 1.00
R4571:Zfp62 UTSW 11 49215742 missense probably damaging 1.00
R4580:Zfp62 UTSW 11 49216272 missense possibly damaging 0.91
R4631:Zfp62 UTSW 11 49217805 makesense probably null
R5022:Zfp62 UTSW 11 49215729 missense probably damaging 0.96
R5023:Zfp62 UTSW 11 49215729 missense probably damaging 0.96
R5289:Zfp62 UTSW 11 49217148 missense probably damaging 0.98
R5362:Zfp62 UTSW 11 49216612 missense probably damaging 1.00
R5685:Zfp62 UTSW 11 49216217 nonsense probably null
R6420:Zfp62 UTSW 11 49216513 missense probably damaging 1.00
R6764:Zfp62 UTSW 11 49215169 missense probably damaging 0.99
R7000:Zfp62 UTSW 11 49216379 nonsense probably null
R7016:Zfp62 UTSW 11 49215937 missense probably damaging 0.98
R7175:Zfp62 UTSW 11 49216753 missense probably damaging 0.99
R7670:Zfp62 UTSW 11 49215076 start gained probably benign
R7686:Zfp62 UTSW 11 49217158 missense probably damaging 1.00
R7801:Zfp62 UTSW 11 49217328 missense possibly damaging 0.88
R8190:Zfp62 UTSW 11 49216075 missense probably damaging 1.00
R8390:Zfp62 UTSW 11 49215192 missense probably benign 0.02
R8401:Zfp62 UTSW 11 49217391 missense probably damaging 1.00
R8479:Zfp62 UTSW 11 49216492 missense probably damaging 0.98
R8735:Zfp62 UTSW 11 49217400 missense probably damaging 1.00
R8809:Zfp62 UTSW 11 49216411 missense probably damaging 0.98
X0011:Zfp62 UTSW 11 49215598 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGGACTTTTCGGAGTAGCT -3'
(R):5'- TGAGCGTGAGATATAGGCCTT -3'

Sequencing Primer
(F):5'- GAAACAGTTCTGGTTTGAGAGTCCAC -3'
(R):5'- GAGTCTCCGATGAACTTTGAGACC -3'
Posted On2019-11-12