Incidental Mutation 'R7675:Sap30l'
ID592425
Institutional Source Beutler Lab
Gene Symbol Sap30l
Ensembl Gene ENSMUSG00000020519
Gene NameSAP30-like
Synonyms2310079P12Rik, L55
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.347) question?
Stock #R7675 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location57801637-57810217 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 57810041 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 174 (K174E)
Ref Sequence ENSEMBL: ENSMUSP00000020826 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020826]
Predicted Effect probably damaging
Transcript: ENSMUST00000020826
AA Change: K174E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000020826
Gene: ENSMUSG00000020519
AA Change: K174E

DomainStartEndE-ValueType
low complexity region 14 22 N/A INTRINSIC
Pfam:zf-SAP30 23 94 4.5e-40 PFAM
Pfam:SAP30_Sin3_bdg 113 165 7.5e-28 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 97% (28/29)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010109A12Rik T C 5: 93,213,374 S96P unknown Het
5730559C18Rik G T 1: 136,216,003 A565E probably benign Het
Acaca A G 11: 84,315,916 E1534G probably benign Het
Adam7 A T 14: 68,499,853 D773E probably benign Het
C130026I21Rik C T 1: 85,247,015 M266I probably benign Het
Cacna1s T A 1: 136,110,874 I1398N probably damaging Het
Calu C T 6: 29,356,517 T14I probably benign Het
Casp8 A G 1: 58,823,947 D2G possibly damaging Het
Cldn1 T C 16: 26,371,511 N39S probably benign Het
Clspn T C 4: 126,566,320 S447P probably benign Het
Eef2k A G 7: 120,858,504 T29A probably benign Het
Elmsan1 G T 12: 84,173,800 P127T probably damaging Het
Fam205c TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG 4: 42,871,823 probably benign Het
Gm5519 G C 19: 33,825,028 G157A probably benign Het
Gm9844 A T 7: 24,862,359 T28S probably benign Het
Gucy2c A G 6: 136,716,032 V723A possibly damaging Het
Ighv1-69 A T 12: 115,623,589 W3R probably damaging Het
Krtap16-1 A G 11: 99,985,433 C382R possibly damaging Het
Lrrc8a G A 2: 30,255,668 D165N probably damaging Het
Naaladl2 T A 3: 24,551,652 M148L probably benign Het
Nphp3 A T 9: 104,016,088 E424D probably benign Het
Prpf40a T C 2: 53,145,636 K714R possibly damaging Het
Ptpn23 A T 9: 110,387,026 L1254* probably null Het
Serpinb9d C T 13: 33,202,776 Q276* probably null Het
Tex14 A G 11: 87,509,678 D432G probably damaging Het
Unc119 G A 11: 78,343,597 G11R probably damaging Het
Usp36 A G 11: 118,263,696 V965A probably benign Het
Vmn2r4 A T 3: 64,415,236 Y21N probably benign Het
Zbtb38 G T 9: 96,685,541 D1163E probably benign Het
Zfp62 A G 11: 49,216,020 I313V possibly damaging Het
Zfp980 C T 4: 145,701,594 Q298* probably null Het
Other mutations in Sap30l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01996:Sap30l APN 11 57809951 nonsense probably null
IGL03156:Sap30l APN 11 57806168 critical splice donor site probably null
R1771:Sap30l UTSW 11 57806099 missense probably damaging 1.00
R1808:Sap30l UTSW 11 57809945 missense probably benign 0.00
R4863:Sap30l UTSW 11 57806054 missense probably damaging 1.00
R7594:Sap30l UTSW 11 57810121 splice site probably null
R7619:Sap30l UTSW 11 57808061 missense probably damaging 1.00
R8720:Sap30l UTSW 11 57808049 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTGGAAGTAGCTTCTCTTCC -3'
(R):5'- TGTGAGAATATAATCCTCCTGACCG -3'

Sequencing Primer
(F):5'- CCCTCTTTGCAGCGTGTAAGATG -3'
(R):5'- TCCTGACCGAGACATTTACAGTATC -3'
Posted On2019-11-12