Incidental Mutation 'R7676:Efhc1'
ID 592437
Institutional Source Beutler Lab
Gene Symbol Efhc1
Ensembl Gene ENSMUSG00000041809
Gene Name EF-hand domain (C-terminal) containing 1
Synonyms 1700029F22Rik, myoclonin1, mRib72-1
MMRRC Submission 045647-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.088) question?
Stock # R7676 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 21021850-21061065 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 21037593 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Tryptophan at position 257 (G257W)
Ref Sequence ENSEMBL: ENSMUSP00000042343 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038447]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000038447
AA Change: G257W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042343
Gene: ENSMUSG00000041809
AA Change: G257W

DomainStartEndE-ValueType
DM10 93 198 2.74e-52 SMART
DM10 239 359 3.04e-59 SMART
DM10 416 520 8.05e-50 SMART
SCOP:d1sra__ 538 646 2e-12 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an EF-hand-containing calcium binding protein. The encoded protein likely plays a role in calcium homeostasis. Mutations in this gene have been associated with susceptibility to juvenile myoclonic epilepsy and juvenile absence epilepsy. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous or heterozygous for a null mutation display myoclonus and increased susceptibility to pharmacologically induced seizures. Homozygous mice also display enlarged brain ventricles and reduced hippocampal size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca A G 11: 84,185,813 (GRCm39) D116G possibly damaging Het
Adam6a G A 12: 113,508,196 (GRCm39) G190S probably benign Het
Adnp G A 2: 168,025,367 (GRCm39) R643* probably null Het
Akap6 A G 12: 52,933,633 (GRCm39) D375G possibly damaging Het
Aldh1l2 G T 10: 83,343,975 (GRCm39) A480E probably benign Het
Ccdc175 T A 12: 72,148,821 (GRCm39) Q779L possibly damaging Het
Dnah7b T G 1: 46,273,324 (GRCm39) L2484* probably null Het
Dnajc21 T C 15: 10,462,430 (GRCm39) Y65C possibly damaging Het
Dnhd1 C A 7: 105,333,294 (GRCm39) N255K probably benign Het
Fars2 C A 13: 36,389,026 (GRCm39) L172I probably benign Het
Fat4 T C 3: 38,945,846 (GRCm39) Y1580H probably damaging Het
Fli1 T A 9: 32,339,326 (GRCm39) N253Y probably benign Het
Foxd3 G T 4: 99,545,151 (GRCm39) C97F probably damaging Het
Gem C A 4: 11,711,170 (GRCm39) D120E possibly damaging Het
Ighv10-3 A G 12: 114,487,299 (GRCm39) C41R probably damaging Het
Katnip A G 7: 125,449,549 (GRCm39) D897G probably benign Het
Kcnab3 A G 11: 69,217,553 (GRCm39) S16G probably benign Het
Keg1 T G 19: 12,693,409 (GRCm39) V154G probably benign Het
Lrrc45 G A 11: 120,611,148 (GRCm39) R602H probably damaging Het
Ltbp1 A G 17: 75,598,292 (GRCm39) D591G possibly damaging Het
Mmp10 T A 9: 7,503,550 (GRCm39) V140D probably damaging Het
Nat8f2 A T 6: 85,845,194 (GRCm39) M56K probably benign Het
Nckipsd T C 9: 108,692,153 (GRCm39) F525L probably damaging Het
Or10ak7 A G 4: 118,791,347 (GRCm39) S233P probably damaging Het
Or10j7 T A 1: 173,011,120 (GRCm39) K294* probably null Het
Or6c6c G T 10: 129,541,155 (GRCm39) S136I possibly damaging Het
P2ry12 T A 3: 59,125,178 (GRCm39) M166L possibly damaging Het
Palm3 T C 8: 84,756,074 (GRCm39) S529P possibly damaging Het
Pdilt A T 7: 119,094,220 (GRCm39) Y344N probably damaging Het
Pip4k2b A T 11: 97,611,188 (GRCm39) N309K probably benign Het
Pkd1l1 C T 11: 8,912,708 (GRCm39) V166I Het
Plxdc2 C T 2: 16,716,894 (GRCm39) S377L probably benign Het
Rc3h2 A T 2: 37,295,344 (GRCm39) V224E possibly damaging Het
Stk32c T A 7: 138,685,220 (GRCm39) D428V possibly damaging Het
Ttn T C 2: 76,644,951 (GRCm39) D12968G probably damaging Het
Tulp2 G T 7: 45,170,451 (GRCm39) V457F possibly damaging Het
Vcan A T 13: 89,839,908 (GRCm39) S1879T probably damaging Het
Vmn1r51 T C 6: 90,106,437 (GRCm39) Y118H probably benign Het
Zfat A C 15: 68,096,693 (GRCm39) V40G possibly damaging Het
Other mutations in Efhc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Efhc1 APN 1 21,049,705 (GRCm39) nonsense probably null
IGL00549:Efhc1 APN 1 21,049,705 (GRCm39) nonsense probably null
IGL01611:Efhc1 APN 1 21,060,911 (GRCm39) makesense probably null
IGL01916:Efhc1 APN 1 21,048,973 (GRCm39) missense probably damaging 1.00
IGL02366:Efhc1 APN 1 21,030,486 (GRCm39) missense probably damaging 0.99
IGL02567:Efhc1 APN 1 21,043,188 (GRCm39) missense probably damaging 0.98
IGL02590:Efhc1 APN 1 21,037,608 (GRCm39) missense probably damaging 1.00
IGL02869:Efhc1 APN 1 21,037,567 (GRCm39) missense probably damaging 0.96
IGL03264:Efhc1 APN 1 21,037,715 (GRCm39) missense probably benign
IGL03292:Efhc1 APN 1 21,030,496 (GRCm39) missense possibly damaging 0.89
IGL03097:Efhc1 UTSW 1 21,043,049 (GRCm39) missense probably damaging 1.00
P0023:Efhc1 UTSW 1 21,025,751 (GRCm39) missense probably benign
R0180:Efhc1 UTSW 1 21,037,713 (GRCm39) missense probably benign
R0220:Efhc1 UTSW 1 21,037,582 (GRCm39) missense probably damaging 0.98
R0391:Efhc1 UTSW 1 21,030,412 (GRCm39) missense probably damaging 1.00
R0765:Efhc1 UTSW 1 21,048,876 (GRCm39) missense probably benign 0.00
R1293:Efhc1 UTSW 1 21,048,996 (GRCm39) missense probably damaging 0.96
R1414:Efhc1 UTSW 1 21,031,513 (GRCm39) missense probably damaging 1.00
R1644:Efhc1 UTSW 1 21,037,625 (GRCm39) nonsense probably null
R1799:Efhc1 UTSW 1 21,049,762 (GRCm39) missense probably benign 0.00
R1932:Efhc1 UTSW 1 21,037,624 (GRCm39) missense probably damaging 1.00
R1991:Efhc1 UTSW 1 21,059,784 (GRCm39) nonsense probably null
R2103:Efhc1 UTSW 1 21,059,784 (GRCm39) nonsense probably null
R3956:Efhc1 UTSW 1 21,048,890 (GRCm39) missense probably damaging 0.96
R4812:Efhc1 UTSW 1 21,060,871 (GRCm39) missense probably damaging 0.99
R5064:Efhc1 UTSW 1 21,045,187 (GRCm39) missense possibly damaging 0.91
R5562:Efhc1 UTSW 1 21,043,104 (GRCm39) missense probably damaging 0.98
R5800:Efhc1 UTSW 1 21,049,005 (GRCm39) missense probably benign 0.00
R5948:Efhc1 UTSW 1 21,043,052 (GRCm39) missense probably damaging 0.99
R5977:Efhc1 UTSW 1 21,030,442 (GRCm39) missense probably damaging 1.00
R6313:Efhc1 UTSW 1 21,049,652 (GRCm39) missense possibly damaging 0.69
R6375:Efhc1 UTSW 1 21,043,164 (GRCm39) missense probably benign 0.05
R6512:Efhc1 UTSW 1 21,030,573 (GRCm39) missense probably damaging 0.99
R6530:Efhc1 UTSW 1 21,031,366 (GRCm39) splice site probably null
R6865:Efhc1 UTSW 1 21,030,442 (GRCm39) missense probably damaging 1.00
R7398:Efhc1 UTSW 1 21,059,744 (GRCm39) missense probably benign
R7656:Efhc1 UTSW 1 21,031,281 (GRCm39) splice site probably null
R7719:Efhc1 UTSW 1 21,049,744 (GRCm39) missense probably benign
R7775:Efhc1 UTSW 1 21,049,685 (GRCm39) missense probably damaging 1.00
R7778:Efhc1 UTSW 1 21,049,685 (GRCm39) missense probably damaging 1.00
R7824:Efhc1 UTSW 1 21,049,685 (GRCm39) missense probably damaging 1.00
R7857:Efhc1 UTSW 1 21,045,226 (GRCm39) missense probably benign 0.11
R7970:Efhc1 UTSW 1 21,022,019 (GRCm39) missense probably benign 0.12
R8187:Efhc1 UTSW 1 21,030,396 (GRCm39) missense probably damaging 1.00
R8485:Efhc1 UTSW 1 21,030,460 (GRCm39) missense possibly damaging 0.95
R8752:Efhc1 UTSW 1 21,059,692 (GRCm39) missense probably benign
R8862:Efhc1 UTSW 1 21,037,573 (GRCm39) missense
R9086:Efhc1 UTSW 1 21,025,592 (GRCm39) missense probably damaging 1.00
R9328:Efhc1 UTSW 1 21,030,598 (GRCm39) missense probably damaging 1.00
R9619:Efhc1 UTSW 1 21,037,603 (GRCm39) missense probably benign 0.03
R9625:Efhc1 UTSW 1 21,049,738 (GRCm39) missense probably benign 0.00
R9747:Efhc1 UTSW 1 21,048,928 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATCTCAGGTTCCTAGGTGTGC -3'
(R):5'- ACCACTGACCCTACTGAGTC -3'

Sequencing Primer
(F):5'- TGCTAGGGTGCCTGAAGC -3'
(R):5'- TGACCCTACTGAGTCCCTCCAAC -3'
Posted On 2019-11-12