Mutagenetix > Incidental Mutation

Incidental Mutation 'R7676:Rc3h2'

592441

Institutional Source

Beutler Lab

Gene Symbol

Rc3h2

Ensembl Gene

ENSMUSG00000075376

Gene Name

ring finger and CCCH-type zinc finger domains 2

Synonyms

Mnab, D930043C02Rik, Rnf164, 2900024N03Rik, 9430019J22Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7676 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

37370069-37422903 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 37405332 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 224 (V224E)

Ref Sequence

ENSEMBL: ENSMUSP00000108556 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000100143] [ENSMUST00000112934] [ENSMUST00000112936] [ENSMUST00000125619]

AlphaFold

P0C090

Predicted Effect

possibly damaging
Transcript: ENSMUST00000100143
AA Change: V224E

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000097721
Gene: ENSMUSG00000075376
AA Change: V224E

Domain	Start	End	E-Value	Type
RING	14	53	2.87e-5	SMART
low complexity region	198	209	N/A	INTRINSIC
ZnF_C3H1	410	437	1.58e-3	SMART
low complexity region	609	633	N/A	INTRINSIC
low complexity region	668	688	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000112934
AA Change: V224E

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000108556
Gene: ENSMUSG00000075376
AA Change: V224E

Domain	Start	End	E-Value	Type
RING	14	53	2.87e-5	SMART
low complexity region	198	209	N/A	INTRINSIC
ZnF_C3H1	410	437	1.58e-3	SMART
low complexity region	609	633	N/A	INTRINSIC
low complexity region	668	688	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000112936
AA Change: V224E

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000108558
Gene: ENSMUSG00000075376
AA Change: V224E

Domain	Start	End	E-Value	Type
RING	14	53	2.87e-5	SMART
low complexity region	198	209	N/A	INTRINSIC
ZnF_C3H1	410	437	1.58e-3	SMART
low complexity region	609	633	N/A	INTRINSIC
low complexity region	668	688	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000125619
AA Change: V224E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000145082
Gene: ENSMUSG00000075376
AA Change: V224E

Domain	Start	End	E-Value	Type
RING	14	53	1.4e-7	SMART
low complexity region	198	209	N/A	INTRINSIC
ZnF_C3H1	410	437	6.9e-6	SMART
low complexity region	455	466	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygotes for a knock-out allele are viable and healthy but show increased TNF production by macrophages in response to LPS. Homozygotes for a different knock-out allele show postnatal lethality, decreased body size and weight, and an immature lung phenotype with decreased alveolar expansion. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acaca	A	G	11: 84,294,987	D116G	possibly damaging	Het
Adam6a	G	A	12: 113,544,576	G190S	probably benign	Het
Adnp	G	A	2: 168,183,447	R643*	probably null	Het
Akap6	A	G	12: 52,886,850	D375G	possibly damaging	Het
Aldh1l2	G	T	10: 83,508,111	A480E	probably benign	Het
Ccdc175	T	A	12: 72,102,047	Q779L	possibly damaging	Het
D430042O09Rik	A	G	7: 125,850,377	D897G	probably benign	Het
Dnah7b	T	G	1: 46,234,164	L2484*	probably null	Het
Dnajc21	T	C	15: 10,462,344	Y65C	possibly damaging	Het
Dnhd1	C	A	7: 105,684,087	N255K	probably benign	Het
Efhc1	G	T	1: 20,967,369	G257W	probably damaging	Het
Fars2	C	A	13: 36,205,043	L172I	probably benign	Het
Fat4	T	C	3: 38,891,697	Y1580H	probably damaging	Het
Fli1	T	A	9: 32,428,030	N253Y	probably benign	Het
Foxd3	G	T	4: 99,656,914	C97F	probably damaging	Het
Gem	C	A	4: 11,711,170	D120E	possibly damaging	Het
Ighv10-3	A	G	12: 114,523,679	C41R	probably damaging	Het
Kcnab3	A	G	11: 69,326,727	S16G	probably benign	Het
Keg1	T	G	19: 12,716,045	V154G	probably benign	Het
Lrrc45	G	A	11: 120,720,322	R602H	probably damaging	Het
Ltbp1	A	G	17: 75,291,297	D591G	possibly damaging	Het
Mmp10	T	A	9: 7,503,549	V140D	probably damaging	Het
Nat8f2	A	T	6: 85,868,212	M56K	probably benign	Het
Nckipsd	T	C	9: 108,814,954	F525L	probably damaging	Het
Olfr1328	A	G	4: 118,934,150	S233P	probably damaging	Het
Olfr1406	T	A	1: 173,183,553	K294*	probably null	Het
Olfr804	G	T	10: 129,705,286	S136I	possibly damaging	Het
P2ry12	T	A	3: 59,217,757	M166L	possibly damaging	Het
Palm3	T	C	8: 84,029,445	S529P	possibly damaging	Het
Pdilt	A	T	7: 119,494,997	Y344N	probably damaging	Het
Pip4k2b	A	T	11: 97,720,362	N309K	probably benign	Het
Pkd1l1	C	T	11: 8,962,708	V166I		Het
Plxdc2	C	T	2: 16,712,083	S377L	probably benign	Het
Stk32c	T	A	7: 139,105,304	D428V	possibly damaging	Het
Ttn	T	C	2: 76,814,607	D12968G	probably damaging	Het
Tulp2	G	T	7: 45,521,027	V457F	possibly damaging	Het
Vcan	A	T	13: 89,691,789	S1879T	probably damaging	Het
Vmn1r51	T	C	6: 90,129,455	Y118H	probably benign	Het
Zfat	A	C	15: 68,224,844	V40G	possibly damaging	Het

Other mutations in Rc3h2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00234:Rc3h2	APN	2	37389747	missense	possibly damaging	0.59
IGL00944:Rc3h2	APN	2	37398238	splice site	probably benign
IGL01065:Rc3h2	APN	2	37377844	splice site	probably benign
IGL01966:Rc3h2	APN	2	37382777	splice site	probably benign
IGL02123:Rc3h2	APN	2	37398253	missense	probably damaging	1.00
IGL02174:Rc3h2	APN	2	37411225	missense	probably benign	0.11
IGL02448:Rc3h2	APN	2	37389805	missense	probably benign	0.08
IGL02539:Rc3h2	APN	2	37389715	missense	probably benign	0.09
IGL02698:Rc3h2	APN	2	37405300	missense	probably damaging	0.99
IGL02731:Rc3h2	APN	2	37382811	missense	probably benign	0.00
IGL02958:Rc3h2	APN	2	37414700	missense	probably damaging	1.00
IGL02959:Rc3h2	APN	2	37405354	missense	probably damaging	1.00
PIT4468001:Rc3h2	UTSW	2	37399639	missense	probably damaging	1.00
R0309:Rc3h2	UTSW	2	37379008	splice site	probably benign
R0488:Rc3h2	UTSW	2	37389588	missense	probably damaging	0.99
R0506:Rc3h2	UTSW	2	37376659	critical splice donor site	probably null
R0612:Rc3h2	UTSW	2	37411215	missense	possibly damaging	0.77
R0628:Rc3h2	UTSW	2	37382052	splice site	probably benign
R0647:Rc3h2	UTSW	2	37409530	missense	probably damaging	1.00
R0680:Rc3h2	UTSW	2	37399835	missense	probably damaging	0.97
R0738:Rc3h2	UTSW	2	37405374	missense	probably damaging	1.00
R2005:Rc3h2	UTSW	2	37389753	nonsense	probably null
R2105:Rc3h2	UTSW	2	37399624	missense	possibly damaging	0.89
R2133:Rc3h2	UTSW	2	37378916	missense	probably benign	0.12
R2373:Rc3h2	UTSW	2	37379001	missense	possibly damaging	0.94
R2414:Rc3h2	UTSW	2	37399819	critical splice donor site	probably null
R2850:Rc3h2	UTSW	2	37377415	missense	probably benign
R2913:Rc3h2	UTSW	2	37378959	missense	possibly damaging	0.89
R2932:Rc3h2	UTSW	2	37378359	missense	probably benign	0.10
R4441:Rc3h2	UTSW	2	37414514	critical splice donor site	probably null
R4932:Rc3h2	UTSW	2	37389832	missense	possibly damaging	0.77
R5114:Rc3h2	UTSW	2	37398361	splice site	probably null
R5169:Rc3h2	UTSW	2	37405312	missense	probably damaging	1.00
R5360:Rc3h2	UTSW	2	37389855	missense	possibly damaging	0.59
R5477:Rc3h2	UTSW	2	37399630	missense	possibly damaging	0.94
R5553:Rc3h2	UTSW	2	37398311	nonsense	probably null
R5776:Rc3h2	UTSW	2	37378313	missense	possibly damaging	0.59
R5842:Rc3h2	UTSW	2	37378371	missense	possibly damaging	0.77
R5935:Rc3h2	UTSW	2	37414733	frame shift	probably null
R6060:Rc3h2	UTSW	2	37399600	missense	possibly damaging	0.77
R6112:Rc3h2	UTSW	2	37378887	missense	possibly damaging	0.59
R6172:Rc3h2	UTSW	2	37414733	frame shift	probably null
R6173:Rc3h2	UTSW	2	37414733	frame shift	probably null
R6177:Rc3h2	UTSW	2	37389646	missense	probably benign	0.02
R6455:Rc3h2	UTSW	2	37409470	missense	probably damaging	1.00
R6457:Rc3h2	UTSW	2	37411139	critical splice donor site	probably null
R6467:Rc3h2	UTSW	2	37382016	missense	probably damaging	0.97
R6647:Rc3h2	UTSW	2	37382944	nonsense	probably null
R6694:Rc3h2	UTSW	2	37400543	missense	probably damaging	1.00
R6695:Rc3h2	UTSW	2	37414661	missense	possibly damaging	0.88
R7054:Rc3h2	UTSW	2	37375246	missense	probably benign	0.07
R7159:Rc3h2	UTSW	2	37409647	missense	probably benign	0.39
R7162:Rc3h2	UTSW	2	37409605	missense	possibly damaging	0.59
R7640:Rc3h2	UTSW	2	37377849	critical splice donor site	probably null
R8209:Rc3h2	UTSW	2	37376989	missense	possibly damaging	0.77
R8226:Rc3h2	UTSW	2	37376989	missense	possibly damaging	0.77
R8324:Rc3h2	UTSW	2	37400726	missense	possibly damaging	0.77
R8528:Rc3h2	UTSW	2	37382799	missense	probably benign	0.05
R8836:Rc3h2	UTSW	2	37377929	missense	possibly damaging	0.59
R8957:Rc3h2	UTSW	2	37399648	missense	possibly damaging	0.59
R9053:Rc3h2	UTSW	2	37399616	missense	possibly damaging	0.95
R9131:Rc3h2	UTSW	2	37414690	missense	possibly damaging	0.94
R9178:Rc3h2	UTSW	2	37405252	missense	possibly damaging	0.77
R9437:Rc3h2	UTSW	2	37382829	missense	possibly damaging	0.94
X0013:Rc3h2	UTSW	2	37389786	missense	possibly damaging	0.60
Z1187:Rc3h2	UTSW	2	37399600	missense	possibly damaging	0.77
Z1188:Rc3h2	UTSW	2	37399600	missense	possibly damaging	0.77
Z1189:Rc3h2	UTSW	2	37409556	missense	possibly damaging	0.94
Z1192:Rc3h2	UTSW	2	37399600	missense	possibly damaging	0.77
Z1192:Rc3h2	UTSW	2	37409556	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- GAGGGTCACTAGATTGGCAAC -3'
(R):5'- ATGAGTTGCTTTGCTGGCAC -3'

Sequencing Primer
(F):5'- TGGCAACATAAATTCTCAGAAGC -3'
(R):5'- GCTGGCACTTGATTGATTTAAAAATG -3'

Posted On

2019-11-12