Mutagenetix > Incidental Mutation

Incidental Mutation 'R7676:Adnp'

592443

Institutional Source

Beutler Lab

Gene Symbol

Adnp

Ensembl Gene

ENSMUSG00000051149

Gene Name

activity-dependent neuroprotective protein

Synonyms

mKIAA0784

MMRRC Submission

Accession Numbers

Genbank: NM_009628; MGI: 1338758

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7676 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

168180986-168207112 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to A at 168183447 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Stop codon at position 643 (R643*)

Ref Sequence

ENSEMBL: ENSMUSP00000085316 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000057793] [ENSMUST00000088001] [ENSMUST00000138667]

AlphaFold

Q9Z103

Predicted Effect

probably null
Transcript: ENSMUST00000057793
AA Change: R643*

SMART Domains

Protein: ENSMUSP00000056809
Gene: ENSMUSG00000051149
AA Change: R643*

Domain	Start	End	E-Value	Type
ZnF_C2H2	74	97	6.57e0	SMART
ZnF_C2H2	107	129	1.77e1	SMART
low complexity region	130	141	N/A	INTRINSIC
ZnF_C2H2	165	188	1.29e1	SMART
ZnF_C2H2	221	244	1.4e1	SMART
low complexity region	423	437	N/A	INTRINSIC
ZnF_C2H2	446	468	8.62e1	SMART
ZnF_C2H2	488	509	2.54e1	SMART
ZnF_C2H2	511	534	1.03e-2	SMART
low complexity region	582	596	N/A	INTRINSIC
ZnF_C2H2	621	646	1.27e2	SMART
HOX	756	817	2.95e-6	SMART
low complexity region	957	970	N/A	INTRINSIC
low complexity region	1012	1023	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000088001
AA Change: R643*

SMART Domains

Protein: ENSMUSP00000085316
Gene: ENSMUSG00000051149
AA Change: R643*

Domain	Start	End	E-Value	Type
ZnF_C2H2	74	97	6.57e0	SMART
ZnF_C2H2	107	129	1.77e1	SMART
low complexity region	130	141	N/A	INTRINSIC
ZnF_C2H2	165	188	1.29e1	SMART
ZnF_C2H2	221	244	1.4e1	SMART
low complexity region	423	437	N/A	INTRINSIC
ZnF_C2H2	446	468	8.62e1	SMART
ZnF_C2H2	488	509	2.54e1	SMART
ZnF_C2H2	511	534	1.03e-2	SMART
low complexity region	582	596	N/A	INTRINSIC
ZnF_C2H2	621	646	1.27e2	SMART
HOX	756	817	2.95e-6	SMART
low complexity region	957	970	N/A	INTRINSIC
low complexity region	1012	1023	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000138667

SMART Domains

Protein: ENSMUSP00000139070
Gene: ENSMUSG00000093752

Domain	Start	End	E-Value	Type
Pfam:Glyco_tranf_2_3	24	240	1.1e-13	PFAM
Pfam:Glyco_tranf_2_2	28	153	8.4e-10	PFAM
Pfam:Glycos_transf_2	28	199	3.8e-40	PFAM
Pfam:Glyco_transf_21	87	200	1.5e-7	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of a protein family characterized by nine zinc finger motifs followed by a homeobox domain. In vitro studies demonstrate that the encoded protein interacts with the brahma-related gene1-associated or hBRM factors (BAF) gene expression regulating complex, components of the protein translation machinery, and microtubule-associated proteins. This gene has been implicated in neuroprotection through various processes that include chromatin remodeling, splicing, cytoskeletal reorganization, and autophagy. Homozygous mutant knockout mice display embryonic lethality with defects in neural tube closure. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2016]
PHENOTYPE: Developmental defects including the failure of the cranial neural tube to close lead to embryonic death between E8.5 and E9. [provided by MGI curators]

Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acaca	A	G	11: 84,294,987	D116G	possibly damaging	Het
Adam6a	G	A	12: 113,544,576	G190S	probably benign	Het
Akap6	A	G	12: 52,886,850	D375G	possibly damaging	Het
Aldh1l2	G	T	10: 83,508,111	A480E	probably benign	Het
Ccdc175	T	A	12: 72,102,047	Q779L	possibly damaging	Het
D430042O09Rik	A	G	7: 125,850,377	D897G	probably benign	Het
Dnah7b	T	G	1: 46,234,164	L2484*	probably null	Het
Dnajc21	T	C	15: 10,462,344	Y65C	possibly damaging	Het
Dnhd1	C	A	7: 105,684,087	N255K	probably benign	Het
Efhc1	G	T	1: 20,967,369	G257W	probably damaging	Het
Fars2	C	A	13: 36,205,043	L172I	probably benign	Het
Fat4	T	C	3: 38,891,697	Y1580H	probably damaging	Het
Fli1	T	A	9: 32,428,030	N253Y	probably benign	Het
Foxd3	G	T	4: 99,656,914	C97F	probably damaging	Het
Gem	C	A	4: 11,711,170	D120E	possibly damaging	Het
Ighv10-3	A	G	12: 114,523,679	C41R	probably damaging	Het
Kcnab3	A	G	11: 69,326,727	S16G	probably benign	Het
Keg1	T	G	19: 12,716,045	V154G	probably benign	Het
Lrrc45	G	A	11: 120,720,322	R602H	probably damaging	Het
Ltbp1	A	G	17: 75,291,297	D591G	possibly damaging	Het
Mmp10	T	A	9: 7,503,549	V140D	probably damaging	Het
Nat8f2	A	T	6: 85,868,212	M56K	probably benign	Het
Nckipsd	T	C	9: 108,814,954	F525L	probably damaging	Het
Olfr1328	A	G	4: 118,934,150	S233P	probably damaging	Het
Olfr1406	T	A	1: 173,183,553	K294*	probably null	Het
Olfr804	G	T	10: 129,705,286	S136I	possibly damaging	Het
P2ry12	T	A	3: 59,217,757	M166L	possibly damaging	Het
Palm3	T	C	8: 84,029,445	S529P	possibly damaging	Het
Pdilt	A	T	7: 119,494,997	Y344N	probably damaging	Het
Pip4k2b	A	T	11: 97,720,362	N309K	probably benign	Het
Pkd1l1	C	T	11: 8,962,708	V166I		Het
Plxdc2	C	T	2: 16,712,083	S377L	probably benign	Het
Rc3h2	A	T	2: 37,405,332	V224E	possibly damaging	Het
Stk32c	T	A	7: 139,105,304	D428V	possibly damaging	Het
Ttn	T	C	2: 76,814,607	D12968G	probably damaging	Het
Tulp2	G	T	7: 45,521,027	V457F	possibly damaging	Het
Vcan	A	T	13: 89,691,789	S1879T	probably damaging	Het
Vmn1r51	T	C	6: 90,129,455	Y118H	probably benign	Het
Zfat	A	C	15: 68,224,844	V40G	possibly damaging	Het

Other mutations in Adnp

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00427:Adnp	APN	2	168182562	missense	probably benign
IGL00500:Adnp	APN	2	168183323	missense	possibly damaging	0.85
IGL01604:Adnp	APN	2	168184338	missense	probably damaging	0.99
IGL01967:Adnp	APN	2	168183419	missense	possibly damaging	0.85
IGL02470:Adnp	APN	2	168183194	missense	probably damaging	0.99
C9142:Adnp	UTSW	2	168184407	missense	probably damaging	0.99
R0893:Adnp	UTSW	2	168183727	missense	possibly damaging	0.85
R1167:Adnp	UTSW	2	168184500	missense	probably benign	0.11
R1182:Adnp	UTSW	2	168184796	missense	possibly damaging	0.77
R1480:Adnp	UTSW	2	168183534	missense	probably damaging	0.99
R1505:Adnp	UTSW	2	168183741	missense	possibly damaging	0.93
R1906:Adnp	UTSW	2	168182367	missense	probably benign
R3711:Adnp	UTSW	2	168184823	missense	probably damaging	0.98
R3943:Adnp	UTSW	2	168185060	missense	possibly damaging	0.92
R4440:Adnp	UTSW	2	168184801	missense	possibly damaging	0.92
R4686:Adnp	UTSW	2	168182389	missense	possibly damaging	0.78
R4916:Adnp	UTSW	2	168187617	missense	possibly damaging	0.91
R5072:Adnp	UTSW	2	168183001	missense	probably damaging	0.96
R5312:Adnp	UTSW	2	168184188	missense	probably benign
R5393:Adnp	UTSW	2	168182949	missense	possibly damaging	0.95
R5598:Adnp	UTSW	2	168183725	missense	probably damaging	0.99
R6230:Adnp	UTSW	2	168182532	missense	probably benign
R7165:Adnp	UTSW	2	168182367	missense	probably benign	0.07
R7176:Adnp	UTSW	2	168182658	missense	probably benign
R7238:Adnp	UTSW	2	168183967	missense	probably damaging	1.00
R7254:Adnp	UTSW	2	168183998	missense	probably damaging	0.99
R7581:Adnp	UTSW	2	168183466	missense	probably damaging	0.96
R7863:Adnp	UTSW	2	168189350	missense	possibly damaging	0.91
R8098:Adnp	UTSW	2	168182532	missense	probably benign
R8196:Adnp	UTSW	2	168183172	missense	probably benign
R8970:Adnp	UTSW	2	168189370	missense	possibly damaging	0.91
R9153:Adnp	UTSW	2	168184660	missense	possibly damaging	0.96
R9154:Adnp	UTSW	2	168184660	missense	possibly damaging	0.96
R9228:Adnp	UTSW	2	168184878	missense	probably damaging	0.98
R9256:Adnp	UTSW	2	168184025	missense	probably damaging	1.00
R9268:Adnp	UTSW	2	168189313	missense	possibly damaging	0.86
R9434:Adnp	UTSW	2	168184457	missense	probably damaging	0.99
R9517:Adnp	UTSW	2	168182946	missense	possibly damaging	0.93
R9621:Adnp	UTSW	2	168182743	missense	probably benign	0.22
R9669:Adnp	UTSW	2	168184998	missense	possibly damaging	0.91
R9737:Adnp	UTSW	2	168184998	missense	possibly damaging	0.91

Predicted Primers

PCR Primer
(F):5'- TGGAGACTGATTGAGCCGAG -3'
(R):5'- ATCAGTTGCTTACCATGCCC -3'

Sequencing Primer
(F):5'- CTGATTGAGCCGAGAAGGTGC -3'
(R):5'- GTTGCTTACCATGCCCAAAATAATGC -3'

Posted On

2019-11-12