Incidental Mutation 'R7676:P2ry12'
ID 592445
Institutional Source Beutler Lab
Gene Symbol P2ry12
Ensembl Gene ENSMUSG00000036353
Gene Name purinergic receptor P2Y, G-protein coupled 12
Synonyms P2Y12, 2900079B22Rik, 4921504D23Rik
MMRRC Submission 045647-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.106) question?
Stock # R7676 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 59123693-59170292 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 59125178 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 166 (M166L)
Ref Sequence ENSEMBL: ENSMUSP00000051353 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040325] [ENSMUST00000050360] [ENSMUST00000164225] [ENSMUST00000170388] [ENSMUST00000196583] [ENSMUST00000199609] [ENSMUST00000199659] [ENSMUST00000199675]
AlphaFold Q9CPV9
Predicted Effect probably benign
Transcript: ENSMUST00000040325
SMART Domains Protein: ENSMUSP00000042269
Gene: ENSMUSG00000056476

DomainStartEndE-ValueType
Med12 101 161 1.71e-24 SMART
low complexity region 216 224 N/A INTRINSIC
low complexity region 269 278 N/A INTRINSIC
Pfam:Med12-LCEWAV 282 730 2.6e-207 PFAM
low complexity region 744 758 N/A INTRINSIC
low complexity region 853 872 N/A INTRINSIC
low complexity region 1455 1466 N/A INTRINSIC
low complexity region 1728 1742 N/A INTRINSIC
low complexity region 1769 1783 N/A INTRINSIC
Pfam:Med12-PQL 1803 2029 2.3e-14 PFAM
low complexity region 2055 2076 N/A INTRINSIC
low complexity region 2083 2101 N/A INTRINSIC
low complexity region 2116 2136 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000050360
AA Change: M166L

PolyPhen 2 Score 0.813 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000051353
Gene: ENSMUSG00000036353
AA Change: M166L

DomainStartEndE-ValueType
Pfam:7tm_1 48 304 1.3e-40 PFAM
low complexity region 322 335 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164225
SMART Domains Protein: ENSMUSP00000127038
Gene: ENSMUSG00000056476

DomainStartEndE-ValueType
Med12 101 161 1.71e-24 SMART
low complexity region 216 224 N/A INTRINSIC
low complexity region 269 278 N/A INTRINSIC
Pfam:Med12-LCEWAV 283 765 5e-187 PFAM
low complexity region 779 793 N/A INTRINSIC
low complexity region 888 907 N/A INTRINSIC
low complexity region 1490 1501 N/A INTRINSIC
low complexity region 1763 1777 N/A INTRINSIC
low complexity region 1804 1818 N/A INTRINSIC
Pfam:Med12-PQL 1840 2063 9.7e-66 PFAM
low complexity region 2090 2111 N/A INTRINSIC
low complexity region 2118 2136 N/A INTRINSIC
low complexity region 2151 2171 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000170388
AA Change: M166L

PolyPhen 2 Score 0.813 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000126819
Gene: ENSMUSG00000036353
AA Change: M166L

DomainStartEndE-ValueType
Pfam:7tm_1 23 304 1.5e-31 PFAM
low complexity region 322 335 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000196583
AA Change: M166L

PolyPhen 2 Score 0.813 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000143036
Gene: ENSMUSG00000036353
AA Change: M166L

DomainStartEndE-ValueType
Pfam:7tm_1 48 304 1.3e-40 PFAM
low complexity region 322 335 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000199609
AA Change: M166L

PolyPhen 2 Score 0.813 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000143521
Gene: ENSMUSG00000036353
AA Change: M166L

DomainStartEndE-ValueType
Pfam:7tm_1 23 304 1.5e-31 PFAM
low complexity region 322 335 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199659
SMART Domains Protein: ENSMUSP00000142903
Gene: ENSMUSG00000056476

DomainStartEndE-ValueType
Med12 101 161 1.71e-24 SMART
low complexity region 216 224 N/A INTRINSIC
low complexity region 269 278 N/A INTRINSIC
Pfam:Med12-LCEWAV 282 765 5.5e-209 PFAM
low complexity region 779 793 N/A INTRINSIC
low complexity region 888 907 N/A INTRINSIC
low complexity region 1490 1501 N/A INTRINSIC
low complexity region 1761 1775 N/A INTRINSIC
low complexity region 1802 1816 N/A INTRINSIC
Pfam:Med12-PQL 1836 2062 1.7e-15 PFAM
low complexity region 2088 2130 N/A INTRINSIC
low complexity region 2144 2164 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199675
SMART Domains Protein: ENSMUSP00000143706
Gene: ENSMUSG00000036353

DomainStartEndE-ValueType
PDB:4PY0|A 2 116 5e-59 PDB
SCOP:d1l9ha_ 3 116 8e-9 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the family of G-protein coupled receptors. This family has several receptor subtypes with different pharmacological selectivity, which overlaps in some cases, for various adenosine and uridine nucleotides. This receptor is involved in platelet aggregation, and is a potential target for the treatment of thromboembolisms and other clotting disorders. Mutations in this gene are implicated in bleeding disorder, platelet type 8 (BDPLT8). Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous mutation of this gene results in impaired platelet activation, increased bleeding time and delayed thrombus formation in injured arteries. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca A G 11: 84,185,813 (GRCm39) D116G possibly damaging Het
Adam6a G A 12: 113,508,196 (GRCm39) G190S probably benign Het
Adnp G A 2: 168,025,367 (GRCm39) R643* probably null Het
Akap6 A G 12: 52,933,633 (GRCm39) D375G possibly damaging Het
Aldh1l2 G T 10: 83,343,975 (GRCm39) A480E probably benign Het
Ccdc175 T A 12: 72,148,821 (GRCm39) Q779L possibly damaging Het
Dnah7b T G 1: 46,273,324 (GRCm39) L2484* probably null Het
Dnajc21 T C 15: 10,462,430 (GRCm39) Y65C possibly damaging Het
Dnhd1 C A 7: 105,333,294 (GRCm39) N255K probably benign Het
Efhc1 G T 1: 21,037,593 (GRCm39) G257W probably damaging Het
Fars2 C A 13: 36,389,026 (GRCm39) L172I probably benign Het
Fat4 T C 3: 38,945,846 (GRCm39) Y1580H probably damaging Het
Fli1 T A 9: 32,339,326 (GRCm39) N253Y probably benign Het
Foxd3 G T 4: 99,545,151 (GRCm39) C97F probably damaging Het
Gem C A 4: 11,711,170 (GRCm39) D120E possibly damaging Het
Ighv10-3 A G 12: 114,487,299 (GRCm39) C41R probably damaging Het
Katnip A G 7: 125,449,549 (GRCm39) D897G probably benign Het
Kcnab3 A G 11: 69,217,553 (GRCm39) S16G probably benign Het
Keg1 T G 19: 12,693,409 (GRCm39) V154G probably benign Het
Lrrc45 G A 11: 120,611,148 (GRCm39) R602H probably damaging Het
Ltbp1 A G 17: 75,598,292 (GRCm39) D591G possibly damaging Het
Mmp10 T A 9: 7,503,550 (GRCm39) V140D probably damaging Het
Nat8f2 A T 6: 85,845,194 (GRCm39) M56K probably benign Het
Nckipsd T C 9: 108,692,153 (GRCm39) F525L probably damaging Het
Or10ak7 A G 4: 118,791,347 (GRCm39) S233P probably damaging Het
Or10j7 T A 1: 173,011,120 (GRCm39) K294* probably null Het
Or6c6c G T 10: 129,541,155 (GRCm39) S136I possibly damaging Het
Palm3 T C 8: 84,756,074 (GRCm39) S529P possibly damaging Het
Pdilt A T 7: 119,094,220 (GRCm39) Y344N probably damaging Het
Pip4k2b A T 11: 97,611,188 (GRCm39) N309K probably benign Het
Pkd1l1 C T 11: 8,912,708 (GRCm39) V166I Het
Plxdc2 C T 2: 16,716,894 (GRCm39) S377L probably benign Het
Rc3h2 A T 2: 37,295,344 (GRCm39) V224E possibly damaging Het
Stk32c T A 7: 138,685,220 (GRCm39) D428V possibly damaging Het
Ttn T C 2: 76,644,951 (GRCm39) D12968G probably damaging Het
Tulp2 G T 7: 45,170,451 (GRCm39) V457F possibly damaging Het
Vcan A T 13: 89,839,908 (GRCm39) S1879T probably damaging Het
Vmn1r51 T C 6: 90,106,437 (GRCm39) Y118H probably benign Het
Zfat A C 15: 68,096,693 (GRCm39) V40G possibly damaging Het
Other mutations in P2ry12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:P2ry12 APN 3 59,125,303 (GRCm39) missense probably damaging 1.00
IGL03075:P2ry12 APN 3 59,125,579 (GRCm39) missense probably damaging 1.00
IGL02796:P2ry12 UTSW 3 59,125,302 (GRCm39) missense probably damaging 1.00
R0707:P2ry12 UTSW 3 59,124,908 (GRCm39) missense probably damaging 1.00
R1274:P2ry12 UTSW 3 59,124,641 (GRCm39) missense possibly damaging 0.83
R1321:P2ry12 UTSW 3 59,124,646 (GRCm39) missense possibly damaging 0.94
R1513:P2ry12 UTSW 3 59,125,498 (GRCm39) missense probably damaging 1.00
R1781:P2ry12 UTSW 3 59,125,199 (GRCm39) missense probably benign 0.04
R2108:P2ry12 UTSW 3 59,124,774 (GRCm39) missense probably damaging 1.00
R3430:P2ry12 UTSW 3 59,125,448 (GRCm39) missense probably damaging 1.00
R4119:P2ry12 UTSW 3 59,125,262 (GRCm39) missense probably benign 0.00
R4499:P2ry12 UTSW 3 59,125,078 (GRCm39) missense probably damaging 0.97
R4501:P2ry12 UTSW 3 59,125,078 (GRCm39) missense probably damaging 0.97
R4670:P2ry12 UTSW 3 59,125,325 (GRCm39) splice site probably null
R4823:P2ry12 UTSW 3 59,125,318 (GRCm39) missense probably benign 0.00
R5643:P2ry12 UTSW 3 59,125,516 (GRCm39) missense possibly damaging 0.96
R5644:P2ry12 UTSW 3 59,125,516 (GRCm39) missense possibly damaging 0.96
R6246:P2ry12 UTSW 3 59,124,950 (GRCm39) missense probably benign 0.00
R6261:P2ry12 UTSW 3 59,125,328 (GRCm39) missense probably null 0.87
R6473:P2ry12 UTSW 3 59,124,932 (GRCm39) missense probably benign 0.06
R6484:P2ry12 UTSW 3 59,124,754 (GRCm39) missense probably damaging 1.00
R6654:P2ry12 UTSW 3 59,125,441 (GRCm39) missense probably damaging 1.00
R7151:P2ry12 UTSW 3 59,125,127 (GRCm39) missense probably benign 0.01
R7446:P2ry12 UTSW 3 59,124,632 (GRCm39) makesense probably null
R7984:P2ry12 UTSW 3 59,125,022 (GRCm39) missense probably damaging 1.00
R8164:P2ry12 UTSW 3 59,125,037 (GRCm39) missense possibly damaging 0.89
R8905:P2ry12 UTSW 3 59,124,997 (GRCm39) missense probably damaging 1.00
R9042:P2ry12 UTSW 3 59,125,456 (GRCm39) missense probably damaging 1.00
R9625:P2ry12 UTSW 3 59,125,496 (GRCm39) missense possibly damaging 0.93
R9651:P2ry12 UTSW 3 59,134,931 (GRCm39) intron probably benign
RF018:P2ry12 UTSW 3 59,124,833 (GRCm39) missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- CCTTGTTCTGACATAAGACCGATAG -3'
(R):5'- CTCTGAGAACCTTGGTGTGC -3'

Sequencing Primer
(F):5'- GACATAAGACCGATAGAGTTCTTTGG -3'
(R):5'- GGTGTGCCAAGTTACTTCAGTCAC -3'
Posted On 2019-11-12