Incidental Mutation 'R7676:Gem'
ID592446
Institutional Source Beutler Lab
Gene Symbol Gem
Ensembl Gene ENSMUSG00000028214
Gene NameGTP binding protein (gene overexpressed in skeletal muscle)
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.214) question?
Stock #R7676 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location11704457-11714752 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 11711170 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 120 (D120E)
Ref Sequence ENSEMBL: ENSMUSP00000103939 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029868] [ENSMUST00000108304]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029868
AA Change: D120E

PolyPhen 2 Score 0.829 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000029868
Gene: ENSMUSG00000028214
AA Change: D120E

DomainStartEndE-ValueType
low complexity region 56 70 N/A INTRINSIC
Pfam:Miro 76 193 4.9e-21 PFAM
Pfam:Ras 76 240 1.9e-32 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000108304
AA Change: D120E

PolyPhen 2 Score 0.829 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103939
Gene: ENSMUSG00000028214
AA Change: D120E

DomainStartEndE-ValueType
low complexity region 56 70 N/A INTRINSIC
Pfam:Roc 76 194 2.6e-11 PFAM
Pfam:Ras 76 240 1.3e-32 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the RAD/GEM family of GTP-binding proteins. It is associated with the inner face of the plasma membrane and could play a role as a regulatory protein in receptor-mediated signal transduction. Alternative splicing occurs at this locus and two transcript variants encoding the same protein have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired glucose tolerance, decreased insulin secretion and abnormal calcium handling in pancreatic beta-cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca A G 11: 84,294,987 D116G possibly damaging Het
Adam6a G A 12: 113,544,576 G190S probably benign Het
Adnp G A 2: 168,183,447 R643* probably null Het
Akap6 A G 12: 52,886,850 D375G possibly damaging Het
Aldh1l2 G T 10: 83,508,111 A480E probably benign Het
Ccdc175 T A 12: 72,102,047 Q779L possibly damaging Het
D430042O09Rik A G 7: 125,850,377 D897G probably benign Het
Dnah7b T G 1: 46,234,164 L2484* probably null Het
Dnajc21 T C 15: 10,462,344 Y65C possibly damaging Het
Dnhd1 C A 7: 105,684,087 N255K probably benign Het
Efhc1 G T 1: 20,967,369 G257W probably damaging Het
Fars2 C A 13: 36,205,043 L172I probably benign Het
Fat4 T C 3: 38,891,697 Y1580H probably damaging Het
Fli1 T A 9: 32,428,030 N253Y probably benign Het
Foxd3 G T 4: 99,656,914 C97F probably damaging Het
Ighv10-3 A G 12: 114,523,679 C41R probably damaging Het
Kcnab3 A G 11: 69,326,727 S16G probably benign Het
Keg1 T G 19: 12,716,045 V154G probably benign Het
Lrrc45 G A 11: 120,720,322 R602H probably damaging Het
Ltbp1 A G 17: 75,291,297 D591G possibly damaging Het
Mmp10 T A 9: 7,503,549 V140D probably damaging Het
Nat8f2 A T 6: 85,868,212 M56K probably benign Het
Nckipsd T C 9: 108,814,954 F525L probably damaging Het
Olfr1328 A G 4: 118,934,150 S233P probably damaging Het
Olfr1406 T A 1: 173,183,553 K294* probably null Het
Olfr804 G T 10: 129,705,286 S136I possibly damaging Het
P2ry12 T A 3: 59,217,757 M166L possibly damaging Het
Palm3 T C 8: 84,029,445 S529P possibly damaging Het
Pdilt A T 7: 119,494,997 Y344N probably damaging Het
Pip4k2b A T 11: 97,720,362 N309K probably benign Het
Pkd1l1 C T 11: 8,962,708 V166I Het
Plxdc2 C T 2: 16,712,083 S377L probably benign Het
Rc3h2 A T 2: 37,405,332 V224E possibly damaging Het
Stk32c T A 7: 139,105,304 D428V possibly damaging Het
Ttn T C 2: 76,814,607 D12968G probably damaging Het
Tulp2 G T 7: 45,521,027 V457F possibly damaging Het
Vcan A T 13: 89,691,789 S1879T probably damaging Het
Vmn1r51 T C 6: 90,129,455 Y118H probably benign Het
Zfat A C 15: 68,224,844 V40G possibly damaging Het
Other mutations in Gem
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01863:Gem APN 4 11705980 missense probably benign
IGL02189:Gem APN 4 11706121 missense possibly damaging 0.94
IGL02571:Gem APN 4 11713628 missense probably benign 0.28
R1565:Gem UTSW 4 11713709 missense possibly damaging 0.62
R3806:Gem UTSW 4 11705965 nonsense probably null
R3893:Gem UTSW 4 11705889 intron probably benign
R4353:Gem UTSW 4 11705939 missense probably damaging 1.00
R4724:Gem UTSW 4 11706074 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GTACATGTTCATGTGGGGCAC -3'
(R):5'- AAGGAAATGAGCCCTCCTCG -3'

Sequencing Primer
(F):5'- CATCTGGATTCTAGAGGTCAGCC -3'
(R):5'- AAATGAGCCCTCCTCGTCTGG -3'
Posted On2019-11-12