Incidental Mutation 'R7676:Foxd3'
ID 592447
Institutional Source Beutler Lab
Gene Symbol Foxd3
Ensembl Gene ENSMUSG00000067261
Gene Name forkhead box D3
Synonyms CWH3, Genesis, Hfh2
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7676 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 99656299-99658622 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 99656914 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Phenylalanine at position 97 (C97F)
Ref Sequence ENSEMBL: ENSMUSP00000084541 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087285]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000087285
AA Change: C97F

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000084541
Gene: ENSMUSG00000067261
AA Change: C97F

DomainStartEndE-ValueType
low complexity region 21 41 N/A INTRINSIC
low complexity region 99 121 N/A INTRINSIC
FH 129 219 1.01e-60 SMART
low complexity region 247 312 N/A INTRINSIC
low complexity region 323 334 N/A INTRINSIC
low complexity region 338 353 N/A INTRINSIC
low complexity region 373 404 N/A INTRINSIC
low complexity region 451 461 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the forkhead family of transcription factors which is characterized by a distinct forkhead domain. Mutations in this gene cause autoimmune susceptibility 1. [provided by RefSeq, Nov 2008]
PHENOTYPE: Mice homozygous for null alleles dsiplay embryonic lethality with failure of primitive streak formation and gastrulation and failure to derive cultures of embryonic or trophoblast stem cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca A G 11: 84,294,987 D116G possibly damaging Het
Adam6a G A 12: 113,544,576 G190S probably benign Het
Adnp G A 2: 168,183,447 R643* probably null Het
Akap6 A G 12: 52,886,850 D375G possibly damaging Het
Aldh1l2 G T 10: 83,508,111 A480E probably benign Het
Ccdc175 T A 12: 72,102,047 Q779L possibly damaging Het
D430042O09Rik A G 7: 125,850,377 D897G probably benign Het
Dnah7b T G 1: 46,234,164 L2484* probably null Het
Dnajc21 T C 15: 10,462,344 Y65C possibly damaging Het
Dnhd1 C A 7: 105,684,087 N255K probably benign Het
Efhc1 G T 1: 20,967,369 G257W probably damaging Het
Fars2 C A 13: 36,205,043 L172I probably benign Het
Fat4 T C 3: 38,891,697 Y1580H probably damaging Het
Fli1 T A 9: 32,428,030 N253Y probably benign Het
Gem C A 4: 11,711,170 D120E possibly damaging Het
Ighv10-3 A G 12: 114,523,679 C41R probably damaging Het
Kcnab3 A G 11: 69,326,727 S16G probably benign Het
Keg1 T G 19: 12,716,045 V154G probably benign Het
Lrrc45 G A 11: 120,720,322 R602H probably damaging Het
Ltbp1 A G 17: 75,291,297 D591G possibly damaging Het
Mmp10 T A 9: 7,503,549 V140D probably damaging Het
Nat8f2 A T 6: 85,868,212 M56K probably benign Het
Nckipsd T C 9: 108,814,954 F525L probably damaging Het
Olfr1328 A G 4: 118,934,150 S233P probably damaging Het
Olfr1406 T A 1: 173,183,553 K294* probably null Het
Olfr804 G T 10: 129,705,286 S136I possibly damaging Het
P2ry12 T A 3: 59,217,757 M166L possibly damaging Het
Palm3 T C 8: 84,029,445 S529P possibly damaging Het
Pdilt A T 7: 119,494,997 Y344N probably damaging Het
Pip4k2b A T 11: 97,720,362 N309K probably benign Het
Pkd1l1 C T 11: 8,962,708 V166I Het
Plxdc2 C T 2: 16,712,083 S377L probably benign Het
Rc3h2 A T 2: 37,405,332 V224E possibly damaging Het
Stk32c T A 7: 139,105,304 D428V possibly damaging Het
Ttn T C 2: 76,814,607 D12968G probably damaging Het
Tulp2 G T 7: 45,521,027 V457F possibly damaging Het
Vcan A T 13: 89,691,789 S1879T probably damaging Het
Vmn1r51 T C 6: 90,129,455 Y118H probably benign Het
Zfat A C 15: 68,224,844 V40G possibly damaging Het
Other mutations in Foxd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02483:Foxd3 APN 4 99657028 missense probably damaging 1.00
IGL02936:Foxd3 APN 4 99656815 missense probably benign 0.41
IGL03392:Foxd3 APN 4 99657195 missense probably damaging 0.99
FR4304:Foxd3 UTSW 4 99657396 small deletion probably benign
R3899:Foxd3 UTSW 4 99657499 missense unknown
R5034:Foxd3 UTSW 4 99657090 missense probably damaging 0.98
R6226:Foxd3 UTSW 4 99657024 missense probably damaging 1.00
R6244:Foxd3 UTSW 4 99657240 missense possibly damaging 0.48
R6272:Foxd3 UTSW 4 99656740 missense probably damaging 1.00
R7152:Foxd3 UTSW 4 99657325 missense probably benign 0.02
R7762:Foxd3 UTSW 4 99657125 nonsense probably null
R7908:Foxd3 UTSW 4 99657339 missense probably benign 0.14
R7993:Foxd3 UTSW 4 99656604 start gained probably benign
RF026:Foxd3 UTSW 4 99657396 small deletion probably benign
RF036:Foxd3 UTSW 4 99657396 small deletion probably benign
RF038:Foxd3 UTSW 4 99657396 small deletion probably benign
Z1176:Foxd3 UTSW 4 99657066 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGACGTGGACATCGATGTG -3'
(R):5'- TGATGAACTCGCAGATGCC -3'

Sequencing Primer
(F):5'- ACATCGATGTGGTGGGCGAG -3'
(R):5'- AGATGCCGCTCAGGGTCAG -3'
Posted On 2019-11-12