Incidental Mutation 'R7676:Tulp2'
ID 592451
Institutional Source Beutler Lab
Gene Symbol Tulp2
Ensembl Gene ENSMUSG00000023467
Gene Name tubby-like protein 2
Synonyms
MMRRC Submission 045647-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.097) question?
Stock # R7676 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 45131450-45173070 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 45170451 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Phenylalanine at position 457 (V457F)
Ref Sequence ENSEMBL: ENSMUSP00000024233 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024233] [ENSMUST00000042105] [ENSMUST00000085331] [ENSMUST00000107758] [ENSMUST00000107759] [ENSMUST00000107762] [ENSMUST00000167273] [ENSMUST00000209763] [ENSMUST00000210299] [ENSMUST00000210532] [ENSMUST00000210813] [ENSMUST00000210868] [ENSMUST00000211212]
AlphaFold P46686
Predicted Effect possibly damaging
Transcript: ENSMUST00000024233
AA Change: V457F

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000024233
Gene: ENSMUSG00000023467
AA Change: V457F

DomainStartEndE-ValueType
low complexity region 67 77 N/A INTRINSIC
low complexity region 212 220 N/A INTRINSIC
Pfam:Tub 315 556 1.1e-116 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000042105
SMART Domains Protein: ENSMUSP00000049488
Gene: ENSMUSG00000040435

DomainStartEndE-ValueType
low complexity region 149 160 N/A INTRINSIC
low complexity region 225 234 N/A INTRINSIC
internal_repeat_1 245 333 1.03e-15 PROSPERO
low complexity region 334 351 N/A INTRINSIC
internal_repeat_1 357 447 1.03e-15 PROSPERO
low complexity region 448 459 N/A INTRINSIC
low complexity region 520 530 N/A INTRINSIC
Pfam:PP1c_bdg 536 612 8.2e-15 PFAM
low complexity region 636 652 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000085331
AA Change: V333F

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000082438
Gene: ENSMUSG00000023467
AA Change: V333F

DomainStartEndE-ValueType
low complexity region 88 96 N/A INTRINSIC
Pfam:Tub 191 432 6.2e-117 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000107758
AA Change: V352F

PolyPhen 2 Score 0.920 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103387
Gene: ENSMUSG00000023467
AA Change: V352F

DomainStartEndE-ValueType
low complexity region 100 108 N/A INTRINSIC
Pfam:Tub 203 451 4.1e-85 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000107759
AA Change: V345F

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103388
Gene: ENSMUSG00000023467
AA Change: V345F

DomainStartEndE-ValueType
low complexity region 100 108 N/A INTRINSIC
Pfam:Tub 203 444 3.4e-117 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000107762
AA Change: V457F

PolyPhen 2 Score 0.695 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000103391
Gene: ENSMUSG00000023467
AA Change: V457F

DomainStartEndE-ValueType
Pfam:Tub_N 39 295 8.8e-36 PFAM
Pfam:Tub 315 556 1.3e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167273
SMART Domains Protein: ENSMUSP00000128497
Gene: ENSMUSG00000040435

DomainStartEndE-ValueType
low complexity region 149 160 N/A INTRINSIC
low complexity region 225 234 N/A INTRINSIC
internal_repeat_1 245 333 1.03e-15 PROSPERO
low complexity region 334 351 N/A INTRINSIC
internal_repeat_1 357 447 1.03e-15 PROSPERO
low complexity region 448 459 N/A INTRINSIC
low complexity region 520 530 N/A INTRINSIC
Pfam:PP1c_bdg 531 612 1.1e-20 PFAM
low complexity region 636 652 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209763
Predicted Effect probably benign
Transcript: ENSMUST00000210299
Predicted Effect probably benign
Transcript: ENSMUST00000210532
Predicted Effect possibly damaging
Transcript: ENSMUST00000210813
AA Change: V352F

PolyPhen 2 Score 0.920 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000210868
AA Change: V345F

PolyPhen 2 Score 0.695 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect probably benign
Transcript: ENSMUST00000211212
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] TULP2 is a member of a family of tubby-like genes (TULPs) that encode proteins of unknown function. Members of this family have been identified in plants, vertebrates, and invertebrates. The TULP proteins share a conserved C-terminal region of approximately 200 amino acid residues. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca A G 11: 84,185,813 (GRCm39) D116G possibly damaging Het
Adam6a G A 12: 113,508,196 (GRCm39) G190S probably benign Het
Adnp G A 2: 168,025,367 (GRCm39) R643* probably null Het
Akap6 A G 12: 52,933,633 (GRCm39) D375G possibly damaging Het
Aldh1l2 G T 10: 83,343,975 (GRCm39) A480E probably benign Het
Ccdc175 T A 12: 72,148,821 (GRCm39) Q779L possibly damaging Het
Dnah7b T G 1: 46,273,324 (GRCm39) L2484* probably null Het
Dnajc21 T C 15: 10,462,430 (GRCm39) Y65C possibly damaging Het
Dnhd1 C A 7: 105,333,294 (GRCm39) N255K probably benign Het
Efhc1 G T 1: 21,037,593 (GRCm39) G257W probably damaging Het
Fars2 C A 13: 36,389,026 (GRCm39) L172I probably benign Het
Fat4 T C 3: 38,945,846 (GRCm39) Y1580H probably damaging Het
Fli1 T A 9: 32,339,326 (GRCm39) N253Y probably benign Het
Foxd3 G T 4: 99,545,151 (GRCm39) C97F probably damaging Het
Gem C A 4: 11,711,170 (GRCm39) D120E possibly damaging Het
Ighv10-3 A G 12: 114,487,299 (GRCm39) C41R probably damaging Het
Katnip A G 7: 125,449,549 (GRCm39) D897G probably benign Het
Kcnab3 A G 11: 69,217,553 (GRCm39) S16G probably benign Het
Keg1 T G 19: 12,693,409 (GRCm39) V154G probably benign Het
Lrrc45 G A 11: 120,611,148 (GRCm39) R602H probably damaging Het
Ltbp1 A G 17: 75,598,292 (GRCm39) D591G possibly damaging Het
Mmp10 T A 9: 7,503,550 (GRCm39) V140D probably damaging Het
Nat8f2 A T 6: 85,845,194 (GRCm39) M56K probably benign Het
Nckipsd T C 9: 108,692,153 (GRCm39) F525L probably damaging Het
Or10ak7 A G 4: 118,791,347 (GRCm39) S233P probably damaging Het
Or10j7 T A 1: 173,011,120 (GRCm39) K294* probably null Het
Or6c6c G T 10: 129,541,155 (GRCm39) S136I possibly damaging Het
P2ry12 T A 3: 59,125,178 (GRCm39) M166L possibly damaging Het
Palm3 T C 8: 84,756,074 (GRCm39) S529P possibly damaging Het
Pdilt A T 7: 119,094,220 (GRCm39) Y344N probably damaging Het
Pip4k2b A T 11: 97,611,188 (GRCm39) N309K probably benign Het
Pkd1l1 C T 11: 8,912,708 (GRCm39) V166I Het
Plxdc2 C T 2: 16,716,894 (GRCm39) S377L probably benign Het
Rc3h2 A T 2: 37,295,344 (GRCm39) V224E possibly damaging Het
Stk32c T A 7: 138,685,220 (GRCm39) D428V possibly damaging Het
Ttn T C 2: 76,644,951 (GRCm39) D12968G probably damaging Het
Vcan A T 13: 89,839,908 (GRCm39) S1879T probably damaging Het
Vmn1r51 T C 6: 90,106,437 (GRCm39) Y118H probably benign Het
Zfat A C 15: 68,096,693 (GRCm39) V40G possibly damaging Het
Other mutations in Tulp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Tulp2 APN 7 45,171,332 (GRCm39) missense probably damaging 1.00
IGL00942:Tulp2 APN 7 45,165,692 (GRCm39) missense possibly damaging 0.87
IGL01881:Tulp2 APN 7 45,170,219 (GRCm39) missense probably damaging 1.00
IGL03240:Tulp2 APN 7 45,171,734 (GRCm39) missense probably damaging 1.00
IGL03242:Tulp2 APN 7 45,171,282 (GRCm39) missense probably damaging 0.99
IGL03353:Tulp2 APN 7 45,165,696 (GRCm39) missense probably damaging 1.00
R0063:Tulp2 UTSW 7 45,170,284 (GRCm39) unclassified probably benign
R0063:Tulp2 UTSW 7 45,170,284 (GRCm39) unclassified probably benign
R0306:Tulp2 UTSW 7 45,168,000 (GRCm39) unclassified probably benign
R0648:Tulp2 UTSW 7 45,169,210 (GRCm39) missense probably damaging 1.00
R0710:Tulp2 UTSW 7 45,170,232 (GRCm39) missense possibly damaging 0.92
R1168:Tulp2 UTSW 7 45,167,266 (GRCm39) missense probably benign
R1345:Tulp2 UTSW 7 45,168,145 (GRCm39) missense probably benign 0.13
R1737:Tulp2 UTSW 7 45,169,201 (GRCm39) missense probably damaging 1.00
R1854:Tulp2 UTSW 7 45,167,367 (GRCm39) missense probably damaging 0.98
R1918:Tulp2 UTSW 7 45,167,365 (GRCm39) missense possibly damaging 0.95
R2356:Tulp2 UTSW 7 45,168,052 (GRCm39) missense possibly damaging 0.85
R3012:Tulp2 UTSW 7 45,168,187 (GRCm39) missense probably damaging 1.00
R3419:Tulp2 UTSW 7 45,168,176 (GRCm39) missense possibly damaging 0.56
R4236:Tulp2 UTSW 7 45,171,298 (GRCm39) missense probably damaging 1.00
R4701:Tulp2 UTSW 7 45,167,348 (GRCm39) missense probably damaging 0.98
R5367:Tulp2 UTSW 7 45,166,075 (GRCm39) missense possibly damaging 0.95
R6056:Tulp2 UTSW 7 45,139,797 (GRCm39) splice site probably null
R6294:Tulp2 UTSW 7 45,164,116 (GRCm39) missense probably damaging 1.00
R6432:Tulp2 UTSW 7 45,168,012 (GRCm39) missense probably benign 0.01
R6875:Tulp2 UTSW 7 45,168,038 (GRCm39) missense probably benign 0.05
R7459:Tulp2 UTSW 7 45,169,227 (GRCm39) missense probably damaging 1.00
R7556:Tulp2 UTSW 7 45,168,005 (GRCm39) splice site probably null
R7883:Tulp2 UTSW 7 45,166,188 (GRCm39) splice site probably null
R8775:Tulp2 UTSW 7 45,164,914 (GRCm39) missense probably benign
R8775-TAIL:Tulp2 UTSW 7 45,164,914 (GRCm39) missense probably benign
R8804:Tulp2 UTSW 7 45,170,398 (GRCm39) missense probably damaging 1.00
Z1088:Tulp2 UTSW 7 45,171,410 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAACCCTGAGCGGAGTTACTG -3'
(R):5'- GGATGGAACTCTGGCAAAGC -3'

Sequencing Primer
(F):5'- TTCCAGACAGTGCCCGGATC -3'
(R):5'- GCCATTCAAGATTCACACATGACCTG -3'
Posted On 2019-11-12