Incidental Mutation 'R7676:Dnhd1'
ID 592452
Institutional Source Beutler Lab
Gene Symbol Dnhd1
Ensembl Gene ENSMUSG00000030882
Gene Name dynein heavy chain domain 1
Synonyms 8030491N06Rik
MMRRC Submission 045647-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.090) question?
Stock # R7676 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 105300034-105371006 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 105333294 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 255 (N255K)
Ref Sequence ENSEMBL: ENSMUSP00000102388 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106776] [ENSMUST00000142874] [ENSMUST00000145988]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000106776
AA Change: N255K

PolyPhen 2 Score 0.091 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000102388
Gene: ENSMUSG00000030882
AA Change: N255K

DomainStartEndE-ValueType
low complexity region 205 224 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142874
Predicted Effect probably benign
Transcript: ENSMUST00000145988
AA Change: N993K

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000121261
Gene: ENSMUSG00000030882
AA Change: N993K

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
low complexity region 102 115 N/A INTRINSIC
low complexity region 183 191 N/A INTRINSIC
low complexity region 253 269 N/A INTRINSIC
low complexity region 943 962 N/A INTRINSIC
Pfam:DHC_N2 1018 1472 4.6e-50 PFAM
Pfam:AAA_6 1652 1875 2.7e-14 PFAM
low complexity region 1906 1918 N/A INTRINSIC
Blast:AAA 1993 2196 1e-34 BLAST
Pfam:AAA_7 2362 2610 3.3e-11 PFAM
low complexity region 2697 2714 N/A INTRINSIC
low complexity region 2722 2733 N/A INTRINSIC
low complexity region 2800 2810 N/A INTRINSIC
low complexity region 3116 3134 N/A INTRINSIC
Pfam:MT 3178 3470 3.9e-16 PFAM
coiled coil region 3590 3642 N/A INTRINSIC
coiled coil region 3816 3843 N/A INTRINSIC
Pfam:Dynein_heavy 3976 4746 7.3e-97 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca A G 11: 84,185,813 (GRCm39) D116G possibly damaging Het
Adam6a G A 12: 113,508,196 (GRCm39) G190S probably benign Het
Adnp G A 2: 168,025,367 (GRCm39) R643* probably null Het
Akap6 A G 12: 52,933,633 (GRCm39) D375G possibly damaging Het
Aldh1l2 G T 10: 83,343,975 (GRCm39) A480E probably benign Het
Ccdc175 T A 12: 72,148,821 (GRCm39) Q779L possibly damaging Het
Dnah7b T G 1: 46,273,324 (GRCm39) L2484* probably null Het
Dnajc21 T C 15: 10,462,430 (GRCm39) Y65C possibly damaging Het
Efhc1 G T 1: 21,037,593 (GRCm39) G257W probably damaging Het
Fars2 C A 13: 36,389,026 (GRCm39) L172I probably benign Het
Fat4 T C 3: 38,945,846 (GRCm39) Y1580H probably damaging Het
Fli1 T A 9: 32,339,326 (GRCm39) N253Y probably benign Het
Foxd3 G T 4: 99,545,151 (GRCm39) C97F probably damaging Het
Gem C A 4: 11,711,170 (GRCm39) D120E possibly damaging Het
Ighv10-3 A G 12: 114,487,299 (GRCm39) C41R probably damaging Het
Katnip A G 7: 125,449,549 (GRCm39) D897G probably benign Het
Kcnab3 A G 11: 69,217,553 (GRCm39) S16G probably benign Het
Keg1 T G 19: 12,693,409 (GRCm39) V154G probably benign Het
Lrrc45 G A 11: 120,611,148 (GRCm39) R602H probably damaging Het
Ltbp1 A G 17: 75,598,292 (GRCm39) D591G possibly damaging Het
Mmp10 T A 9: 7,503,550 (GRCm39) V140D probably damaging Het
Nat8f2 A T 6: 85,845,194 (GRCm39) M56K probably benign Het
Nckipsd T C 9: 108,692,153 (GRCm39) F525L probably damaging Het
Or10ak7 A G 4: 118,791,347 (GRCm39) S233P probably damaging Het
Or10j7 T A 1: 173,011,120 (GRCm39) K294* probably null Het
Or6c6c G T 10: 129,541,155 (GRCm39) S136I possibly damaging Het
P2ry12 T A 3: 59,125,178 (GRCm39) M166L possibly damaging Het
Palm3 T C 8: 84,756,074 (GRCm39) S529P possibly damaging Het
Pdilt A T 7: 119,094,220 (GRCm39) Y344N probably damaging Het
Pip4k2b A T 11: 97,611,188 (GRCm39) N309K probably benign Het
Pkd1l1 C T 11: 8,912,708 (GRCm39) V166I Het
Plxdc2 C T 2: 16,716,894 (GRCm39) S377L probably benign Het
Rc3h2 A T 2: 37,295,344 (GRCm39) V224E possibly damaging Het
Stk32c T A 7: 138,685,220 (GRCm39) D428V possibly damaging Het
Ttn T C 2: 76,644,951 (GRCm39) D12968G probably damaging Het
Tulp2 G T 7: 45,170,451 (GRCm39) V457F possibly damaging Het
Vcan A T 13: 89,839,908 (GRCm39) S1879T probably damaging Het
Vmn1r51 T C 6: 90,106,437 (GRCm39) Y118H probably benign Het
Zfat A C 15: 68,096,693 (GRCm39) V40G possibly damaging Het
Other mutations in Dnhd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Dnhd1 APN 7 105,327,202 (GRCm39) missense probably damaging 1.00
IGL00516:Dnhd1 APN 7 105,306,418 (GRCm39) missense possibly damaging 0.52
IGL00576:Dnhd1 APN 7 105,341,882 (GRCm39) missense probably damaging 1.00
IGL00990:Dnhd1 APN 7 105,370,895 (GRCm39) missense possibly damaging 0.85
IGL01346:Dnhd1 APN 7 105,363,116 (GRCm39) missense probably benign
IGL01714:Dnhd1 APN 7 105,370,149 (GRCm39) missense probably damaging 1.00
IGL01735:Dnhd1 APN 7 105,362,961 (GRCm39) missense probably benign 0.37
IGL01814:Dnhd1 APN 7 105,301,237 (GRCm39) missense probably benign
IGL01999:Dnhd1 APN 7 105,370,422 (GRCm39) missense possibly damaging 0.50
IGL02022:Dnhd1 APN 7 105,327,516 (GRCm39) missense probably damaging 1.00
IGL02131:Dnhd1 APN 7 105,370,009 (GRCm39) missense probably damaging 1.00
IGL02156:Dnhd1 APN 7 105,370,951 (GRCm39) missense probably damaging 1.00
IGL02674:Dnhd1 APN 7 105,370,688 (GRCm39) missense probably benign 0.00
IGL02966:Dnhd1 APN 7 105,369,948 (GRCm39) missense probably benign 0.00
IGL03066:Dnhd1 APN 7 105,369,089 (GRCm39) missense probably damaging 0.99
IGL03298:Dnhd1 APN 7 105,363,682 (GRCm39) missense probably damaging 0.98
IGL03378:Dnhd1 APN 7 105,362,940 (GRCm39) missense possibly damaging 0.87
IGL02802:Dnhd1 UTSW 7 105,304,930 (GRCm39) missense possibly damaging 0.83
R0060:Dnhd1 UTSW 7 105,317,721 (GRCm39) missense probably damaging 0.99
R0129:Dnhd1 UTSW 7 105,370,131 (GRCm39) missense probably benign 0.19
R0238:Dnhd1 UTSW 7 105,370,738 (GRCm39) missense probably benign 0.06
R0238:Dnhd1 UTSW 7 105,370,738 (GRCm39) missense probably benign 0.06
R0239:Dnhd1 UTSW 7 105,370,738 (GRCm39) missense probably benign 0.06
R0239:Dnhd1 UTSW 7 105,370,738 (GRCm39) missense probably benign 0.06
R0384:Dnhd1 UTSW 7 105,369,321 (GRCm39) missense possibly damaging 0.56
R0453:Dnhd1 UTSW 7 105,323,651 (GRCm39) missense probably benign 0.00
R0540:Dnhd1 UTSW 7 105,369,995 (GRCm39) missense probably benign 0.04
R0554:Dnhd1 UTSW 7 105,343,602 (GRCm39) missense probably benign 0.10
R0576:Dnhd1 UTSW 7 105,363,252 (GRCm39) missense probably damaging 1.00
R0607:Dnhd1 UTSW 7 105,369,995 (GRCm39) missense probably benign 0.04
R0631:Dnhd1 UTSW 7 105,300,831 (GRCm39) missense probably benign 0.17
R0639:Dnhd1 UTSW 7 105,345,671 (GRCm39) missense possibly damaging 0.95
R0668:Dnhd1 UTSW 7 105,344,958 (GRCm39) missense probably benign
R0669:Dnhd1 UTSW 7 105,342,911 (GRCm39) missense probably benign 0.01
R0670:Dnhd1 UTSW 7 105,345,671 (GRCm39) missense possibly damaging 0.95
R0699:Dnhd1 UTSW 7 105,301,113 (GRCm39) missense probably damaging 0.98
R1019:Dnhd1 UTSW 7 105,358,378 (GRCm39) missense probably damaging 1.00
R1144:Dnhd1 UTSW 7 105,362,238 (GRCm39) missense probably damaging 1.00
R1226:Dnhd1 UTSW 7 105,346,106 (GRCm39) missense probably damaging 1.00
R1257:Dnhd1 UTSW 7 105,343,360 (GRCm39) missense probably damaging 1.00
R1391:Dnhd1 UTSW 7 105,369,331 (GRCm39) missense probably damaging 1.00
R1453:Dnhd1 UTSW 7 105,370,480 (GRCm39) critical splice donor site probably null
R1501:Dnhd1 UTSW 7 105,317,670 (GRCm39) missense probably benign 0.00
R1503:Dnhd1 UTSW 7 105,342,867 (GRCm39) missense possibly damaging 0.67
R1515:Dnhd1 UTSW 7 105,353,355 (GRCm39) missense probably benign 0.11
R1615:Dnhd1 UTSW 7 105,362,913 (GRCm39) missense possibly damaging 0.74
R1615:Dnhd1 UTSW 7 105,352,413 (GRCm39) missense probably benign 0.00
R1656:Dnhd1 UTSW 7 105,363,488 (GRCm39) missense probably damaging 1.00
R1720:Dnhd1 UTSW 7 105,343,035 (GRCm39) missense probably benign
R1723:Dnhd1 UTSW 7 105,364,127 (GRCm39) missense possibly damaging 0.60
R1766:Dnhd1 UTSW 7 105,343,179 (GRCm39) missense possibly damaging 0.50
R1799:Dnhd1 UTSW 7 105,304,974 (GRCm39) missense probably benign 0.31
R1860:Dnhd1 UTSW 7 105,353,412 (GRCm39) missense probably benign
R1920:Dnhd1 UTSW 7 105,362,614 (GRCm39) missense probably benign 0.00
R1925:Dnhd1 UTSW 7 105,323,061 (GRCm39) missense probably damaging 0.96
R1925:Dnhd1 UTSW 7 105,301,459 (GRCm39) missense probably damaging 1.00
R1934:Dnhd1 UTSW 7 105,357,789 (GRCm39) missense probably benign 0.05
R1935:Dnhd1 UTSW 7 105,323,183 (GRCm39) missense probably benign 0.09
R1936:Dnhd1 UTSW 7 105,323,183 (GRCm39) missense probably benign 0.09
R2035:Dnhd1 UTSW 7 105,354,128 (GRCm39) missense probably damaging 0.99
R2125:Dnhd1 UTSW 7 105,327,178 (GRCm39) missense probably benign 0.35
R2127:Dnhd1 UTSW 7 105,342,928 (GRCm39) missense possibly damaging 0.56
R2254:Dnhd1 UTSW 7 105,352,979 (GRCm39) missense probably damaging 1.00
R2301:Dnhd1 UTSW 7 105,354,606 (GRCm39) missense probably damaging 1.00
R2316:Dnhd1 UTSW 7 105,323,628 (GRCm39) missense probably damaging 1.00
R2324:Dnhd1 UTSW 7 105,359,297 (GRCm39) missense probably damaging 1.00
R2337:Dnhd1 UTSW 7 105,352,674 (GRCm39) missense probably benign 0.07
R2381:Dnhd1 UTSW 7 105,342,871 (GRCm39) missense probably benign 0.42
R2394:Dnhd1 UTSW 7 105,369,438 (GRCm39) missense probably benign 0.19
R2862:Dnhd1 UTSW 7 105,361,766 (GRCm39) missense probably benign 0.01
R3038:Dnhd1 UTSW 7 105,369,436 (GRCm39) missense probably damaging 0.99
R3114:Dnhd1 UTSW 7 105,345,772 (GRCm39) critical splice donor site probably null
R3404:Dnhd1 UTSW 7 105,343,968 (GRCm39) nonsense probably null
R3405:Dnhd1 UTSW 7 105,343,968 (GRCm39) nonsense probably null
R3439:Dnhd1 UTSW 7 105,343,992 (GRCm39) missense probably damaging 1.00
R3959:Dnhd1 UTSW 7 105,362,329 (GRCm39) missense probably benign 0.21
R4014:Dnhd1 UTSW 7 105,364,045 (GRCm39) missense probably damaging 0.99
R4084:Dnhd1 UTSW 7 105,358,795 (GRCm39) missense probably damaging 1.00
R4181:Dnhd1 UTSW 7 105,343,161 (GRCm39) missense probably damaging 1.00
R4255:Dnhd1 UTSW 7 105,362,205 (GRCm39) missense probably damaging 1.00
R4302:Dnhd1 UTSW 7 105,343,161 (GRCm39) missense probably damaging 1.00
R4440:Dnhd1 UTSW 7 105,345,935 (GRCm39) nonsense probably null
R4565:Dnhd1 UTSW 7 105,301,163 (GRCm39) missense possibly damaging 0.92
R4569:Dnhd1 UTSW 7 105,306,373 (GRCm39) splice site probably null
R4584:Dnhd1 UTSW 7 105,327,256 (GRCm39) missense probably damaging 1.00
R4586:Dnhd1 UTSW 7 105,327,256 (GRCm39) missense probably damaging 1.00
R4590:Dnhd1 UTSW 7 105,363,237 (GRCm39) missense probably damaging 1.00
R4593:Dnhd1 UTSW 7 105,364,653 (GRCm39) missense probably benign 0.02
R4600:Dnhd1 UTSW 7 105,352,851 (GRCm39) missense probably damaging 1.00
R4705:Dnhd1 UTSW 7 105,304,948 (GRCm39) missense probably damaging 1.00
R4731:Dnhd1 UTSW 7 105,323,056 (GRCm39) missense probably benign 0.00
R4732:Dnhd1 UTSW 7 105,323,056 (GRCm39) missense probably benign 0.00
R4733:Dnhd1 UTSW 7 105,323,056 (GRCm39) missense probably benign 0.00
R4786:Dnhd1 UTSW 7 105,323,651 (GRCm39) missense probably benign 0.00
R4791:Dnhd1 UTSW 7 105,370,324 (GRCm39) missense probably damaging 1.00
R4811:Dnhd1 UTSW 7 105,363,488 (GRCm39) missense probably damaging 0.99
R4822:Dnhd1 UTSW 7 105,353,171 (GRCm39) missense probably benign 0.00
R4886:Dnhd1 UTSW 7 105,364,015 (GRCm39) missense probably benign 0.00
R4890:Dnhd1 UTSW 7 105,306,164 (GRCm39) missense possibly damaging 0.47
R4973:Dnhd1 UTSW 7 105,362,840 (GRCm39) missense probably benign 0.24
R5007:Dnhd1 UTSW 7 105,362,283 (GRCm39) missense probably damaging 1.00
R5048:Dnhd1 UTSW 7 105,342,904 (GRCm39) missense probably benign 0.01
R5151:Dnhd1 UTSW 7 105,362,647 (GRCm39) missense probably benign 0.22
R5179:Dnhd1 UTSW 7 105,363,759 (GRCm39) missense probably damaging 1.00
R5182:Dnhd1 UTSW 7 105,352,416 (GRCm39) missense probably damaging 1.00
R5183:Dnhd1 UTSW 7 105,352,416 (GRCm39) missense probably damaging 1.00
R5185:Dnhd1 UTSW 7 105,352,416 (GRCm39) missense probably damaging 1.00
R5209:Dnhd1 UTSW 7 105,345,667 (GRCm39) missense probably benign 0.00
R5225:Dnhd1 UTSW 7 105,353,130 (GRCm39) missense possibly damaging 0.73
R5250:Dnhd1 UTSW 7 105,334,968 (GRCm39) missense probably damaging 1.00
R5257:Dnhd1 UTSW 7 105,323,244 (GRCm39) missense probably benign
R5258:Dnhd1 UTSW 7 105,323,244 (GRCm39) missense probably benign
R5273:Dnhd1 UTSW 7 105,363,689 (GRCm39) missense probably damaging 0.99
R5288:Dnhd1 UTSW 7 105,363,644 (GRCm39) missense possibly damaging 0.94
R5396:Dnhd1 UTSW 7 105,362,891 (GRCm39) missense probably benign 0.00
R5453:Dnhd1 UTSW 7 105,359,330 (GRCm39) missense probably damaging 1.00
R5511:Dnhd1 UTSW 7 105,363,363 (GRCm39) missense probably damaging 1.00
R5518:Dnhd1 UTSW 7 105,352,416 (GRCm39) missense probably damaging 1.00
R5523:Dnhd1 UTSW 7 105,352,416 (GRCm39) missense probably damaging 1.00
R5528:Dnhd1 UTSW 7 105,352,416 (GRCm39) missense probably damaging 1.00
R5529:Dnhd1 UTSW 7 105,352,416 (GRCm39) missense probably damaging 1.00
R5561:Dnhd1 UTSW 7 105,364,028 (GRCm39) missense probably damaging 0.99
R5681:Dnhd1 UTSW 7 105,352,416 (GRCm39) missense probably damaging 1.00
R5682:Dnhd1 UTSW 7 105,352,416 (GRCm39) missense probably damaging 1.00
R5683:Dnhd1 UTSW 7 105,352,416 (GRCm39) missense probably damaging 1.00
R5684:Dnhd1 UTSW 7 105,352,416 (GRCm39) missense probably damaging 1.00
R5686:Dnhd1 UTSW 7 105,352,416 (GRCm39) missense probably damaging 1.00
R5697:Dnhd1 UTSW 7 105,323,395 (GRCm39) missense probably damaging 1.00
R5789:Dnhd1 UTSW 7 105,354,217 (GRCm39) missense possibly damaging 0.50
R5790:Dnhd1 UTSW 7 105,304,981 (GRCm39) missense probably damaging 1.00
R5814:Dnhd1 UTSW 7 105,369,102 (GRCm39) missense possibly damaging 0.69
R5828:Dnhd1 UTSW 7 105,369,388 (GRCm39) missense probably benign 0.00
R5852:Dnhd1 UTSW 7 105,344,955 (GRCm39) missense probably damaging 1.00
R5883:Dnhd1 UTSW 7 105,369,711 (GRCm39) missense probably damaging 0.98
R6115:Dnhd1 UTSW 7 105,363,194 (GRCm39) missense probably benign 0.00
R6119:Dnhd1 UTSW 7 105,358,647 (GRCm39) missense probably benign 0.18
R6212:Dnhd1 UTSW 7 105,353,255 (GRCm39) missense probably damaging 1.00
R6243:Dnhd1 UTSW 7 105,301,216 (GRCm39) missense probably damaging 1.00
R6265:Dnhd1 UTSW 7 105,342,577 (GRCm39) missense probably benign 0.07
R6332:Dnhd1 UTSW 7 105,343,273 (GRCm39) missense probably benign 0.02
R6344:Dnhd1 UTSW 7 105,343,817 (GRCm39) missense probably benign 0.38
R6477:Dnhd1 UTSW 7 105,327,093 (GRCm39) missense probably benign 0.05
R6642:Dnhd1 UTSW 7 105,353,006 (GRCm39) missense probably benign
R6663:Dnhd1 UTSW 7 105,334,899 (GRCm39) splice site probably null
R6730:Dnhd1 UTSW 7 105,353,082 (GRCm39) missense probably benign 0.00
R6748:Dnhd1 UTSW 7 105,369,844 (GRCm39) missense probably benign 0.03
R6833:Dnhd1 UTSW 7 105,352,580 (GRCm39) missense probably benign 0.01
R6850:Dnhd1 UTSW 7 105,369,137 (GRCm39) missense possibly damaging 0.68
R6853:Dnhd1 UTSW 7 105,352,935 (GRCm39) missense probably benign
R6860:Dnhd1 UTSW 7 105,327,473 (GRCm39) missense probably benign
R6898:Dnhd1 UTSW 7 105,336,584 (GRCm39) missense probably damaging 0.99
R6927:Dnhd1 UTSW 7 105,364,770 (GRCm39) missense probably damaging 1.00
R6952:Dnhd1 UTSW 7 105,362,895 (GRCm39) missense probably damaging 1.00
R6987:Dnhd1 UTSW 7 105,353,792 (GRCm39) missense probably damaging 0.98
R6988:Dnhd1 UTSW 7 105,363,417 (GRCm39) missense probably damaging 1.00
R7022:Dnhd1 UTSW 7 105,370,005 (GRCm39) missense probably benign 0.36
R7053:Dnhd1 UTSW 7 105,344,161 (GRCm39) missense probably damaging 1.00
R7085:Dnhd1 UTSW 7 105,364,468 (GRCm39) missense probably benign 0.26
R7086:Dnhd1 UTSW 7 105,357,739 (GRCm39) missense probably benign 0.03
R7112:Dnhd1 UTSW 7 105,363,192 (GRCm39) missense probably damaging 1.00
R7140:Dnhd1 UTSW 7 105,342,973 (GRCm39) missense probably benign 0.00
R7151:Dnhd1 UTSW 7 105,359,234 (GRCm39) missense probably benign 0.03
R7178:Dnhd1 UTSW 7 105,344,200 (GRCm39) missense probably damaging 0.98
R7326:Dnhd1 UTSW 7 105,370,137 (GRCm39) missense probably damaging 0.96
R7345:Dnhd1 UTSW 7 105,353,174 (GRCm39) missense probably benign 0.17
R7349:Dnhd1 UTSW 7 105,359,330 (GRCm39) missense probably damaging 1.00
R7397:Dnhd1 UTSW 7 105,354,504 (GRCm39) missense possibly damaging 0.87
R7520:Dnhd1 UTSW 7 105,345,255 (GRCm39) missense probably benign 0.07
R7536:Dnhd1 UTSW 7 105,358,768 (GRCm39) missense probably damaging 1.00
R7539:Dnhd1 UTSW 7 105,370,119 (GRCm39) missense probably damaging 1.00
R7541:Dnhd1 UTSW 7 105,327,516 (GRCm39) missense probably damaging 1.00
R7619:Dnhd1 UTSW 7 105,323,475 (GRCm39) missense probably benign 0.01
R7689:Dnhd1 UTSW 7 105,363,170 (GRCm39) missense probably benign 0.07
R7712:Dnhd1 UTSW 7 105,300,831 (GRCm39) missense probably benign 0.17
R7729:Dnhd1 UTSW 7 105,354,472 (GRCm39) missense probably damaging 1.00
R7767:Dnhd1 UTSW 7 105,343,817 (GRCm39) missense probably benign 0.38
R7768:Dnhd1 UTSW 7 105,370,302 (GRCm39) missense possibly damaging 0.87
R7779:Dnhd1 UTSW 7 105,327,122 (GRCm39) missense probably benign 0.01
R7879:Dnhd1 UTSW 7 105,352,646 (GRCm39) missense probably benign 0.09
R7922:Dnhd1 UTSW 7 105,317,721 (GRCm39) missense probably damaging 1.00
R7951:Dnhd1 UTSW 7 105,327,211 (GRCm39) missense probably damaging 1.00
R8259:Dnhd1 UTSW 7 105,343,995 (GRCm39) missense probably benign 0.38
R8350:Dnhd1 UTSW 7 105,327,231 (GRCm39) missense probably damaging 0.99
R8380:Dnhd1 UTSW 7 105,327,073 (GRCm39) missense probably benign 0.31
R8392:Dnhd1 UTSW 7 105,352,550 (GRCm39) missense possibly damaging 0.84
R8478:Dnhd1 UTSW 7 105,332,001 (GRCm39) missense probably benign 0.00
R8708:Dnhd1 UTSW 7 105,343,487 (GRCm39) nonsense probably null
R8767:Dnhd1 UTSW 7 105,301,330 (GRCm39) missense probably damaging 1.00
R8825:Dnhd1 UTSW 7 105,343,174 (GRCm39) missense possibly damaging 0.95
R8849:Dnhd1 UTSW 7 105,370,723 (GRCm39) missense probably benign 0.00
R8903:Dnhd1 UTSW 7 105,362,855 (GRCm39) nonsense probably null
R8910:Dnhd1 UTSW 7 105,332,904 (GRCm39) missense possibly damaging 0.92
R8940:Dnhd1 UTSW 7 105,363,854 (GRCm39) intron probably benign
R8954:Dnhd1 UTSW 7 105,343,986 (GRCm39) missense probably benign 0.35
R8956:Dnhd1 UTSW 7 105,341,852 (GRCm39) missense probably damaging 0.99
R8971:Dnhd1 UTSW 7 105,358,528 (GRCm39) nonsense probably null
R8996:Dnhd1 UTSW 7 105,323,242 (GRCm39) missense probably damaging 1.00
R9051:Dnhd1 UTSW 7 105,341,933 (GRCm39) missense possibly damaging 0.54
R9058:Dnhd1 UTSW 7 105,333,270 (GRCm39) missense probably benign 0.01
R9109:Dnhd1 UTSW 7 105,333,173 (GRCm39) missense probably damaging 0.98
R9284:Dnhd1 UTSW 7 105,301,091 (GRCm39) missense probably damaging 1.00
R9295:Dnhd1 UTSW 7 105,363,348 (GRCm39) missense probably benign
R9298:Dnhd1 UTSW 7 105,333,173 (GRCm39) missense probably damaging 0.98
R9299:Dnhd1 UTSW 7 105,369,806 (GRCm39) missense probably benign 0.00
R9308:Dnhd1 UTSW 7 105,353,484 (GRCm39) missense probably damaging 1.00
R9337:Dnhd1 UTSW 7 105,369,806 (GRCm39) missense probably benign 0.00
R9385:Dnhd1 UTSW 7 105,361,972 (GRCm39) missense probably damaging 1.00
R9463:Dnhd1 UTSW 7 105,344,223 (GRCm39) missense probably benign
R9463:Dnhd1 UTSW 7 105,306,454 (GRCm39) missense probably benign 0.00
R9476:Dnhd1 UTSW 7 105,352,889 (GRCm39) missense possibly damaging 0.74
R9489:Dnhd1 UTSW 7 105,300,804 (GRCm39) missense probably benign
R9500:Dnhd1 UTSW 7 105,353,709 (GRCm39) missense probably benign
R9510:Dnhd1 UTSW 7 105,352,889 (GRCm39) missense possibly damaging 0.74
R9513:Dnhd1 UTSW 7 105,354,179 (GRCm39) missense probably damaging 1.00
R9537:Dnhd1 UTSW 7 105,344,740 (GRCm39) missense probably damaging 0.99
R9567:Dnhd1 UTSW 7 105,353,473 (GRCm39) missense probably benign 0.03
R9622:Dnhd1 UTSW 7 105,353,342 (GRCm39) missense probably benign
R9623:Dnhd1 UTSW 7 105,344,134 (GRCm39) missense probably damaging 1.00
R9623:Dnhd1 UTSW 7 105,335,773 (GRCm39) missense probably damaging 1.00
R9674:Dnhd1 UTSW 7 105,363,429 (GRCm39) missense probably damaging 1.00
R9756:Dnhd1 UTSW 7 105,353,135 (GRCm39) missense probably benign 0.19
R9777:Dnhd1 UTSW 7 105,369,456 (GRCm39) missense probably benign 0.14
R9778:Dnhd1 UTSW 7 105,353,240 (GRCm39) missense probably benign
R9781:Dnhd1 UTSW 7 105,352,917 (GRCm39) missense probably benign 0.31
R9796:Dnhd1 UTSW 7 105,342,537 (GRCm39) missense probably damaging 1.00
Z1088:Dnhd1 UTSW 7 105,361,934 (GRCm39) missense probably benign 0.00
Z1176:Dnhd1 UTSW 7 105,352,243 (GRCm39) critical splice acceptor site probably null
Z1176:Dnhd1 UTSW 7 105,327,506 (GRCm39) missense probably benign
Z1176:Dnhd1 UTSW 7 105,317,754 (GRCm39) missense probably damaging 0.98
Z1176:Dnhd1 UTSW 7 105,352,787 (GRCm39) frame shift probably null
Z1177:Dnhd1 UTSW 7 105,332,048 (GRCm39) missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- AACATGCCATTGTGCCCAGG -3'
(R):5'- ACTGTGAACTCCCTGTATCCAC -3'

Sequencing Primer
(F):5'- ATTGTGCCCAGGCTGCAG -3'
(R):5'- TGTATCCACTAACATAACAGCTGAG -3'
Posted On 2019-11-12