Incidental Mutation 'R7676:Pdilt'
ID 592453
Institutional Source Beutler Lab
Gene Symbol Pdilt
Ensembl Gene ENSMUSG00000030968
Gene Name protein disulfide isomerase-like, testis expressed
Synonyms PDILT, 1700007B13Rik
MMRRC Submission 045647-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.118) question?
Stock # R7676 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 119085810-119122712 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 119094220 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 344 (Y344N)
Ref Sequence ENSEMBL: ENSMUSP00000033267 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033267] [ENSMUST00000208275]
AlphaFold Q9DAN1
Predicted Effect probably damaging
Transcript: ENSMUST00000033267
AA Change: Y344N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033267
Gene: ENSMUSG00000030968
AA Change: Y344N

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 86 97 N/A INTRINSIC
Pfam:Thioredoxin_6 177 362 6e-35 PFAM
Pfam:Thioredoxin 385 489 3.7e-16 PFAM
low complexity region 495 512 N/A INTRINSIC
low complexity region 551 579 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000208275
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disulfide isomerase (PDI) family of endoplasmic reticulum (ER) proteins that catalyze protein folding and thiol-disulfide interchange reactions. The encoded protein has has an N-terminal ER-signal sequence, two thioredoxin (TRX) domains with non-classical Ser-Lys-Gln-Ser and Ser-Lys-Lys-Cys motifs, respectively, two TRX-like domains, and a C-terminal ER-retention sequence. The protein lacks oxidoreductase activity in vitro and probably functions as a chaperone. This gene's expression appears to be limited to the testis. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit male infertility and abnormal sperm physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca A G 11: 84,185,813 (GRCm39) D116G possibly damaging Het
Adam6a G A 12: 113,508,196 (GRCm39) G190S probably benign Het
Adnp G A 2: 168,025,367 (GRCm39) R643* probably null Het
Akap6 A G 12: 52,933,633 (GRCm39) D375G possibly damaging Het
Aldh1l2 G T 10: 83,343,975 (GRCm39) A480E probably benign Het
Ccdc175 T A 12: 72,148,821 (GRCm39) Q779L possibly damaging Het
Dnah7b T G 1: 46,273,324 (GRCm39) L2484* probably null Het
Dnajc21 T C 15: 10,462,430 (GRCm39) Y65C possibly damaging Het
Dnhd1 C A 7: 105,333,294 (GRCm39) N255K probably benign Het
Efhc1 G T 1: 21,037,593 (GRCm39) G257W probably damaging Het
Fars2 C A 13: 36,389,026 (GRCm39) L172I probably benign Het
Fat4 T C 3: 38,945,846 (GRCm39) Y1580H probably damaging Het
Fli1 T A 9: 32,339,326 (GRCm39) N253Y probably benign Het
Foxd3 G T 4: 99,545,151 (GRCm39) C97F probably damaging Het
Gem C A 4: 11,711,170 (GRCm39) D120E possibly damaging Het
Ighv10-3 A G 12: 114,487,299 (GRCm39) C41R probably damaging Het
Katnip A G 7: 125,449,549 (GRCm39) D897G probably benign Het
Kcnab3 A G 11: 69,217,553 (GRCm39) S16G probably benign Het
Keg1 T G 19: 12,693,409 (GRCm39) V154G probably benign Het
Lrrc45 G A 11: 120,611,148 (GRCm39) R602H probably damaging Het
Ltbp1 A G 17: 75,598,292 (GRCm39) D591G possibly damaging Het
Mmp10 T A 9: 7,503,550 (GRCm39) V140D probably damaging Het
Nat8f2 A T 6: 85,845,194 (GRCm39) M56K probably benign Het
Nckipsd T C 9: 108,692,153 (GRCm39) F525L probably damaging Het
Or10ak7 A G 4: 118,791,347 (GRCm39) S233P probably damaging Het
Or10j7 T A 1: 173,011,120 (GRCm39) K294* probably null Het
Or6c6c G T 10: 129,541,155 (GRCm39) S136I possibly damaging Het
P2ry12 T A 3: 59,125,178 (GRCm39) M166L possibly damaging Het
Palm3 T C 8: 84,756,074 (GRCm39) S529P possibly damaging Het
Pip4k2b A T 11: 97,611,188 (GRCm39) N309K probably benign Het
Pkd1l1 C T 11: 8,912,708 (GRCm39) V166I Het
Plxdc2 C T 2: 16,716,894 (GRCm39) S377L probably benign Het
Rc3h2 A T 2: 37,295,344 (GRCm39) V224E possibly damaging Het
Stk32c T A 7: 138,685,220 (GRCm39) D428V possibly damaging Het
Ttn T C 2: 76,644,951 (GRCm39) D12968G probably damaging Het
Tulp2 G T 7: 45,170,451 (GRCm39) V457F possibly damaging Het
Vcan A T 13: 89,839,908 (GRCm39) S1879T probably damaging Het
Vmn1r51 T C 6: 90,106,437 (GRCm39) Y118H probably benign Het
Zfat A C 15: 68,096,693 (GRCm39) V40G possibly damaging Het
Other mutations in Pdilt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02002:Pdilt APN 7 119,099,667 (GRCm39) missense probably damaging 1.00
IGL02102:Pdilt APN 7 119,086,173 (GRCm39) missense probably benign 0.28
IGL02312:Pdilt APN 7 119,118,890 (GRCm39) missense probably benign 0.03
IGL02887:Pdilt APN 7 119,097,272 (GRCm39) missense possibly damaging 0.86
R0670:Pdilt UTSW 7 119,099,651 (GRCm39) missense probably benign 0.03
R0759:Pdilt UTSW 7 119,088,707 (GRCm39) nonsense probably null
R1525:Pdilt UTSW 7 119,087,217 (GRCm39) missense probably damaging 0.99
R1612:Pdilt UTSW 7 119,086,198 (GRCm39) missense possibly damaging 0.95
R1633:Pdilt UTSW 7 119,087,217 (GRCm39) missense probably damaging 1.00
R1848:Pdilt UTSW 7 119,088,607 (GRCm39) missense probably benign 0.02
R3026:Pdilt UTSW 7 119,114,177 (GRCm39) missense probably benign 0.01
R3546:Pdilt UTSW 7 119,099,711 (GRCm39) nonsense probably null
R4406:Pdilt UTSW 7 119,094,232 (GRCm39) missense probably damaging 1.00
R5331:Pdilt UTSW 7 119,114,147 (GRCm39) missense possibly damaging 0.67
R5459:Pdilt UTSW 7 119,086,158 (GRCm39) missense probably benign 0.01
R5771:Pdilt UTSW 7 119,094,217 (GRCm39) missense probably damaging 0.98
R5807:Pdilt UTSW 7 119,099,766 (GRCm39) unclassified probably benign
R6143:Pdilt UTSW 7 119,094,265 (GRCm39) missense probably damaging 1.00
R6456:Pdilt UTSW 7 119,099,706 (GRCm39) missense probably damaging 0.99
R6850:Pdilt UTSW 7 119,086,182 (GRCm39) missense probably damaging 0.98
R7159:Pdilt UTSW 7 119,087,174 (GRCm39) missense probably benign 0.01
R8266:Pdilt UTSW 7 119,088,604 (GRCm39) missense probably benign 0.01
R8282:Pdilt UTSW 7 119,097,293 (GRCm39) missense probably damaging 1.00
R8437:Pdilt UTSW 7 119,114,109 (GRCm39) missense possibly damaging 0.95
R8951:Pdilt UTSW 7 119,099,611 (GRCm39) missense possibly damaging 0.82
R9581:Pdilt UTSW 7 119,099,633 (GRCm39) missense probably damaging 0.96
R9588:Pdilt UTSW 7 119,100,870 (GRCm39) missense probably benign
R9672:Pdilt UTSW 7 119,100,824 (GRCm39) missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CTCGTGTCACGTTGAACCTC -3'
(R):5'- GGGGTGCTCCTTAATCCTTG -3'

Sequencing Primer
(F):5'- TCACGTTGAACCTCGGCAC -3'
(R):5'- ATTAGTTCCTAGCTTCTCAGTGG -3'
Posted On 2019-11-12