Incidental Mutation 'R7676:Stk32c'
ID 592455
Institutional Source Beutler Lab
Gene Symbol Stk32c
Ensembl Gene ENSMUSG00000015981
Gene Name serine/threonine kinase 32C
Synonyms Pkek, YANK3
MMRRC Submission 045647-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7676 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 138683554-138793223 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 138685220 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 428 (D428V)
Ref Sequence ENSEMBL: ENSMUSP00000016125 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016125] [ENSMUST00000026551] [ENSMUST00000121184] [ENSMUST00000165870]
AlphaFold Q8QZV4
Predicted Effect possibly damaging
Transcript: ENSMUST00000016125
AA Change: D428V

PolyPhen 2 Score 0.869 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000016125
Gene: ENSMUSG00000015981
AA Change: D428V

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
low complexity region 32 48 N/A INTRINSIC
low complexity region 62 80 N/A INTRINSIC
S_TKc 94 354 9.16e-82 SMART
low complexity region 398 407 N/A INTRINSIC
low complexity region 408 418 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000026551
SMART Domains Protein: ENSMUSP00000026551
Gene: ENSMUSG00000025478

DomainStartEndE-ValueType
Pfam:Amidohydro_1 64 453 4.5e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121184
SMART Domains Protein: ENSMUSP00000112896
Gene: ENSMUSG00000025478

DomainStartEndE-ValueType
Pfam:Amidohydro_1 85 474 1.1e-41 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000165870
AA Change: D310V

PolyPhen 2 Score 0.869 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000126638
Gene: ENSMUSG00000015981
AA Change: D310V

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 232 1.2e-30 PFAM
Pfam:Pkinase 1 235 1.5e-51 PFAM
Pfam:Kinase-like 12 223 6.2e-13 PFAM
low complexity region 280 289 N/A INTRINSIC
low complexity region 290 300 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the serine/threonine protein kinase family. It is thought that this family member is functional in brain due to its high expression levels there. DNA methylation differences have been found in this gene in monozygotic twins that are discordant for adolescent depression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca A G 11: 84,185,813 (GRCm39) D116G possibly damaging Het
Adam6a G A 12: 113,508,196 (GRCm39) G190S probably benign Het
Adnp G A 2: 168,025,367 (GRCm39) R643* probably null Het
Akap6 A G 12: 52,933,633 (GRCm39) D375G possibly damaging Het
Aldh1l2 G T 10: 83,343,975 (GRCm39) A480E probably benign Het
Ccdc175 T A 12: 72,148,821 (GRCm39) Q779L possibly damaging Het
Dnah7b T G 1: 46,273,324 (GRCm39) L2484* probably null Het
Dnajc21 T C 15: 10,462,430 (GRCm39) Y65C possibly damaging Het
Dnhd1 C A 7: 105,333,294 (GRCm39) N255K probably benign Het
Efhc1 G T 1: 21,037,593 (GRCm39) G257W probably damaging Het
Fars2 C A 13: 36,389,026 (GRCm39) L172I probably benign Het
Fat4 T C 3: 38,945,846 (GRCm39) Y1580H probably damaging Het
Fli1 T A 9: 32,339,326 (GRCm39) N253Y probably benign Het
Foxd3 G T 4: 99,545,151 (GRCm39) C97F probably damaging Het
Gem C A 4: 11,711,170 (GRCm39) D120E possibly damaging Het
Ighv10-3 A G 12: 114,487,299 (GRCm39) C41R probably damaging Het
Katnip A G 7: 125,449,549 (GRCm39) D897G probably benign Het
Kcnab3 A G 11: 69,217,553 (GRCm39) S16G probably benign Het
Keg1 T G 19: 12,693,409 (GRCm39) V154G probably benign Het
Lrrc45 G A 11: 120,611,148 (GRCm39) R602H probably damaging Het
Ltbp1 A G 17: 75,598,292 (GRCm39) D591G possibly damaging Het
Mmp10 T A 9: 7,503,550 (GRCm39) V140D probably damaging Het
Nat8f2 A T 6: 85,845,194 (GRCm39) M56K probably benign Het
Nckipsd T C 9: 108,692,153 (GRCm39) F525L probably damaging Het
Or10ak7 A G 4: 118,791,347 (GRCm39) S233P probably damaging Het
Or10j7 T A 1: 173,011,120 (GRCm39) K294* probably null Het
Or6c6c G T 10: 129,541,155 (GRCm39) S136I possibly damaging Het
P2ry12 T A 3: 59,125,178 (GRCm39) M166L possibly damaging Het
Palm3 T C 8: 84,756,074 (GRCm39) S529P possibly damaging Het
Pdilt A T 7: 119,094,220 (GRCm39) Y344N probably damaging Het
Pip4k2b A T 11: 97,611,188 (GRCm39) N309K probably benign Het
Pkd1l1 C T 11: 8,912,708 (GRCm39) V166I Het
Plxdc2 C T 2: 16,716,894 (GRCm39) S377L probably benign Het
Rc3h2 A T 2: 37,295,344 (GRCm39) V224E possibly damaging Het
Ttn T C 2: 76,644,951 (GRCm39) D12968G probably damaging Het
Tulp2 G T 7: 45,170,451 (GRCm39) V457F possibly damaging Het
Vcan A T 13: 89,839,908 (GRCm39) S1879T probably damaging Het
Vmn1r51 T C 6: 90,106,437 (GRCm39) Y118H probably benign Het
Zfat A C 15: 68,096,693 (GRCm39) V40G possibly damaging Het
Other mutations in Stk32c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02003:Stk32c APN 7 138,768,069 (GRCm39) missense possibly damaging 0.47
IGL02559:Stk32c APN 7 138,700,606 (GRCm39) missense probably benign 0.00
IGL02805:Stk32c APN 7 138,701,762 (GRCm39) missense probably damaging 1.00
R0531:Stk32c UTSW 7 138,700,636 (GRCm39) missense probably damaging 0.97
R0622:Stk32c UTSW 7 138,768,026 (GRCm39) missense probably benign 0.00
R1140:Stk32c UTSW 7 138,705,095 (GRCm39) missense probably damaging 0.99
R1473:Stk32c UTSW 7 138,705,095 (GRCm39) missense probably damaging 0.99
R1589:Stk32c UTSW 7 138,698,931 (GRCm39) critical splice donor site probably null
R1697:Stk32c UTSW 7 138,701,740 (GRCm39) missense probably benign 0.25
R1855:Stk32c UTSW 7 138,701,363 (GRCm39) missense probably damaging 0.97
R4290:Stk32c UTSW 7 138,700,704 (GRCm39) critical splice acceptor site probably null
R4293:Stk32c UTSW 7 138,700,704 (GRCm39) critical splice acceptor site probably null
R4295:Stk32c UTSW 7 138,700,704 (GRCm39) critical splice acceptor site probably null
R5323:Stk32c UTSW 7 138,699,276 (GRCm39) missense probably benign 0.07
R5854:Stk32c UTSW 7 138,768,195 (GRCm39) intron probably benign
R5907:Stk32c UTSW 7 138,700,590 (GRCm39) missense probably benign 0.32
R6115:Stk32c UTSW 7 138,700,628 (GRCm39) nonsense probably null
R6117:Stk32c UTSW 7 138,702,839 (GRCm39) nonsense probably null
R6176:Stk32c UTSW 7 138,700,691 (GRCm39) missense probably benign 0.02
R6460:Stk32c UTSW 7 138,685,190 (GRCm39) missense probably damaging 1.00
R6695:Stk32c UTSW 7 138,702,880 (GRCm39) missense probably damaging 1.00
R6745:Stk32c UTSW 7 138,702,809 (GRCm39) missense probably damaging 0.99
R7177:Stk32c UTSW 7 138,684,218 (GRCm39) missense possibly damaging 0.62
R7721:Stk32c UTSW 7 138,768,069 (GRCm39) missense possibly damaging 0.47
R8977:Stk32c UTSW 7 138,705,161 (GRCm39) missense possibly damaging 0.69
R9004:Stk32c UTSW 7 138,702,859 (GRCm39) missense probably damaging 1.00
R9117:Stk32c UTSW 7 138,768,141 (GRCm39) missense unknown
R9481:Stk32c UTSW 7 138,768,173 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- CTAAGTCCGCCTAGAAGGTTCC -3'
(R):5'- CTGCTCTCAGCTTTTGGAGATG -3'

Sequencing Primer
(F):5'- TAGAAGGTTCCCAGAGGCCTG -3'
(R):5'- CAGCTTTTGGAGATGATAGACTTC -3'
Posted On 2019-11-12