Incidental Mutation 'R7676:Palm3'
ID 592456
Institutional Source Beutler Lab
Gene Symbol Palm3
Ensembl Gene ENSMUSG00000047986
Gene Name paralemmin 3
Synonyms 4432412L15Rik
MMRRC Submission 045647-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.063) question?
Stock # R7676 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 84748100-84756924 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 84756074 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 529 (S529P)
Ref Sequence ENSEMBL: ENSMUSP00000051396 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005601] [ENSMUST00000055077]
AlphaFold A2TJV2
Predicted Effect probably benign
Transcript: ENSMUST00000005601
SMART Domains Protein: ENSMUSP00000005601
Gene: ENSMUSG00000005465

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Blast:FN3 31 101 2e-6 BLAST
FN3 123 210 3.85e-3 SMART
FN3 314 396 3.78e0 SMART
Blast:FN3 411 492 4e-36 BLAST
low complexity region 516 532 N/A INTRINSIC
low complexity region 584 596 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000055077
AA Change: S529P

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000051396
Gene: ENSMUSG00000047986
AA Change: S529P

DomainStartEndE-ValueType
coiled coil region 19 64 N/A INTRINSIC
low complexity region 69 81 N/A INTRINSIC
coiled coil region 90 116 N/A INTRINSIC
low complexity region 167 178 N/A INTRINSIC
low complexity region 248 261 N/A INTRINSIC
low complexity region 277 293 N/A INTRINSIC
low complexity region 337 349 N/A INTRINSIC
low complexity region 399 416 N/A INTRINSIC
low complexity region 635 647 N/A INTRINSIC
low complexity region 707 720 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142367
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154171
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210245
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca A G 11: 84,185,813 (GRCm39) D116G possibly damaging Het
Adam6a G A 12: 113,508,196 (GRCm39) G190S probably benign Het
Adnp G A 2: 168,025,367 (GRCm39) R643* probably null Het
Akap6 A G 12: 52,933,633 (GRCm39) D375G possibly damaging Het
Aldh1l2 G T 10: 83,343,975 (GRCm39) A480E probably benign Het
Ccdc175 T A 12: 72,148,821 (GRCm39) Q779L possibly damaging Het
Dnah7b T G 1: 46,273,324 (GRCm39) L2484* probably null Het
Dnajc21 T C 15: 10,462,430 (GRCm39) Y65C possibly damaging Het
Dnhd1 C A 7: 105,333,294 (GRCm39) N255K probably benign Het
Efhc1 G T 1: 21,037,593 (GRCm39) G257W probably damaging Het
Fars2 C A 13: 36,389,026 (GRCm39) L172I probably benign Het
Fat4 T C 3: 38,945,846 (GRCm39) Y1580H probably damaging Het
Fli1 T A 9: 32,339,326 (GRCm39) N253Y probably benign Het
Foxd3 G T 4: 99,545,151 (GRCm39) C97F probably damaging Het
Gem C A 4: 11,711,170 (GRCm39) D120E possibly damaging Het
Ighv10-3 A G 12: 114,487,299 (GRCm39) C41R probably damaging Het
Katnip A G 7: 125,449,549 (GRCm39) D897G probably benign Het
Kcnab3 A G 11: 69,217,553 (GRCm39) S16G probably benign Het
Keg1 T G 19: 12,693,409 (GRCm39) V154G probably benign Het
Lrrc45 G A 11: 120,611,148 (GRCm39) R602H probably damaging Het
Ltbp1 A G 17: 75,598,292 (GRCm39) D591G possibly damaging Het
Mmp10 T A 9: 7,503,550 (GRCm39) V140D probably damaging Het
Nat8f2 A T 6: 85,845,194 (GRCm39) M56K probably benign Het
Nckipsd T C 9: 108,692,153 (GRCm39) F525L probably damaging Het
Or10ak7 A G 4: 118,791,347 (GRCm39) S233P probably damaging Het
Or10j7 T A 1: 173,011,120 (GRCm39) K294* probably null Het
Or6c6c G T 10: 129,541,155 (GRCm39) S136I possibly damaging Het
P2ry12 T A 3: 59,125,178 (GRCm39) M166L possibly damaging Het
Pdilt A T 7: 119,094,220 (GRCm39) Y344N probably damaging Het
Pip4k2b A T 11: 97,611,188 (GRCm39) N309K probably benign Het
Pkd1l1 C T 11: 8,912,708 (GRCm39) V166I Het
Plxdc2 C T 2: 16,716,894 (GRCm39) S377L probably benign Het
Rc3h2 A T 2: 37,295,344 (GRCm39) V224E possibly damaging Het
Stk32c T A 7: 138,685,220 (GRCm39) D428V possibly damaging Het
Ttn T C 2: 76,644,951 (GRCm39) D12968G probably damaging Het
Tulp2 G T 7: 45,170,451 (GRCm39) V457F possibly damaging Het
Vcan A T 13: 89,839,908 (GRCm39) S1879T probably damaging Het
Vmn1r51 T C 6: 90,106,437 (GRCm39) Y118H probably benign Het
Zfat A C 15: 68,096,693 (GRCm39) V40G possibly damaging Het
Other mutations in Palm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01307:Palm3 APN 8 84,756,074 (GRCm39) missense possibly damaging 0.90
IGL02634:Palm3 APN 8 84,755,494 (GRCm39) missense probably damaging 0.99
IGL02710:Palm3 APN 8 84,754,941 (GRCm39) missense possibly damaging 0.75
R0277:Palm3 UTSW 8 84,755,349 (GRCm39) missense probably damaging 1.00
R0323:Palm3 UTSW 8 84,755,349 (GRCm39) missense probably damaging 1.00
R0422:Palm3 UTSW 8 84,755,492 (GRCm39) missense possibly damaging 0.94
R0507:Palm3 UTSW 8 84,754,958 (GRCm39) missense probably benign 0.00
R0835:Palm3 UTSW 8 84,754,776 (GRCm39) missense probably benign
R1037:Palm3 UTSW 8 84,755,901 (GRCm39) missense probably benign
R1618:Palm3 UTSW 8 84,756,291 (GRCm39) missense possibly damaging 0.92
R1621:Palm3 UTSW 8 84,756,651 (GRCm39) missense possibly damaging 0.93
R1797:Palm3 UTSW 8 84,755,432 (GRCm39) missense probably benign 0.00
R1989:Palm3 UTSW 8 84,756,651 (GRCm39) missense possibly damaging 0.93
R3618:Palm3 UTSW 8 84,755,973 (GRCm39) missense probably benign 0.00
R3619:Palm3 UTSW 8 84,755,973 (GRCm39) missense probably benign 0.00
R4495:Palm3 UTSW 8 84,753,495 (GRCm39) missense probably damaging 1.00
R4588:Palm3 UTSW 8 84,756,015 (GRCm39) missense probably benign 0.20
R4687:Palm3 UTSW 8 84,756,564 (GRCm39) missense probably benign 0.00
R4948:Palm3 UTSW 8 84,753,708 (GRCm39) nonsense probably null
R5265:Palm3 UTSW 8 84,748,159 (GRCm39) critical splice donor site probably null
R5951:Palm3 UTSW 8 84,756,049 (GRCm39) missense probably benign 0.02
R6580:Palm3 UTSW 8 84,756,177 (GRCm39) missense probably damaging 1.00
R7237:Palm3 UTSW 8 84,756,117 (GRCm39) missense probably benign 0.00
R7562:Palm3 UTSW 8 84,748,136 (GRCm39) missense possibly damaging 0.87
R7923:Palm3 UTSW 8 84,756,090 (GRCm39) missense probably benign
R8118:Palm3 UTSW 8 84,756,438 (GRCm39) missense probably damaging 1.00
R8680:Palm3 UTSW 8 84,756,504 (GRCm39) missense probably damaging 1.00
R9500:Palm3 UTSW 8 84,753,636 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTCCAGCAGAGATAGCAACAG -3'
(R):5'- TGTCCACCTCAGAGAATGGC -3'

Sequencing Primer
(F):5'- TTCCAGCAGAGATAGCAACAGATGAG -3'
(R):5'- GCTCGATGCCATCTGCC -3'
Posted On 2019-11-12