Incidental Mutation 'R7676:Palm3'
ID592456
Institutional Source Beutler Lab
Gene Symbol Palm3
Ensembl Gene ENSMUSG00000047986
Gene Nameparalemmin 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R7676 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location84021471-84030295 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 84029445 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 529 (S529P)
Ref Sequence ENSEMBL: ENSMUSP00000051396 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005601] [ENSMUST00000055077]
Predicted Effect probably benign
Transcript: ENSMUST00000005601
SMART Domains Protein: ENSMUSP00000005601
Gene: ENSMUSG00000005465

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Blast:FN3 31 101 2e-6 BLAST
FN3 123 210 3.85e-3 SMART
FN3 314 396 3.78e0 SMART
Blast:FN3 411 492 4e-36 BLAST
low complexity region 516 532 N/A INTRINSIC
low complexity region 584 596 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000055077
AA Change: S529P

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000051396
Gene: ENSMUSG00000047986
AA Change: S529P

DomainStartEndE-ValueType
coiled coil region 19 64 N/A INTRINSIC
low complexity region 69 81 N/A INTRINSIC
coiled coil region 90 116 N/A INTRINSIC
low complexity region 167 178 N/A INTRINSIC
low complexity region 248 261 N/A INTRINSIC
low complexity region 277 293 N/A INTRINSIC
low complexity region 337 349 N/A INTRINSIC
low complexity region 399 416 N/A INTRINSIC
low complexity region 635 647 N/A INTRINSIC
low complexity region 707 720 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142367
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154171
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210245
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca A G 11: 84,294,987 D116G possibly damaging Het
Adam6a G A 12: 113,544,576 G190S probably benign Het
Adnp G A 2: 168,183,447 R643* probably null Het
Akap6 A G 12: 52,886,850 D375G possibly damaging Het
Aldh1l2 G T 10: 83,508,111 A480E probably benign Het
Ccdc175 T A 12: 72,102,047 Q779L possibly damaging Het
D430042O09Rik A G 7: 125,850,377 D897G probably benign Het
Dnah7b T G 1: 46,234,164 L2484* probably null Het
Dnajc21 T C 15: 10,462,344 Y65C possibly damaging Het
Dnhd1 C A 7: 105,684,087 N255K probably benign Het
Efhc1 G T 1: 20,967,369 G257W probably damaging Het
Fars2 C A 13: 36,205,043 L172I probably benign Het
Fat4 T C 3: 38,891,697 Y1580H probably damaging Het
Fli1 T A 9: 32,428,030 N253Y probably benign Het
Foxd3 G T 4: 99,656,914 C97F probably damaging Het
Gem C A 4: 11,711,170 D120E possibly damaging Het
Ighv10-3 A G 12: 114,523,679 C41R probably damaging Het
Kcnab3 A G 11: 69,326,727 S16G probably benign Het
Keg1 T G 19: 12,716,045 V154G probably benign Het
Lrrc45 G A 11: 120,720,322 R602H probably damaging Het
Ltbp1 A G 17: 75,291,297 D591G possibly damaging Het
Mmp10 T A 9: 7,503,549 V140D probably damaging Het
Nat8f2 A T 6: 85,868,212 M56K probably benign Het
Nckipsd T C 9: 108,814,954 F525L probably damaging Het
Olfr1328 A G 4: 118,934,150 S233P probably damaging Het
Olfr1406 T A 1: 173,183,553 K294* probably null Het
Olfr804 G T 10: 129,705,286 S136I possibly damaging Het
P2ry12 T A 3: 59,217,757 M166L possibly damaging Het
Pdilt A T 7: 119,494,997 Y344N probably damaging Het
Pip4k2b A T 11: 97,720,362 N309K probably benign Het
Pkd1l1 C T 11: 8,962,708 V166I Het
Plxdc2 C T 2: 16,712,083 S377L probably benign Het
Rc3h2 A T 2: 37,405,332 V224E possibly damaging Het
Stk32c T A 7: 139,105,304 D428V possibly damaging Het
Ttn T C 2: 76,814,607 D12968G probably damaging Het
Tulp2 G T 7: 45,521,027 V457F possibly damaging Het
Vcan A T 13: 89,691,789 S1879T probably damaging Het
Vmn1r51 T C 6: 90,129,455 Y118H probably benign Het
Zfat A C 15: 68,224,844 V40G possibly damaging Het
Other mutations in Palm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01307:Palm3 APN 8 84029445 missense possibly damaging 0.90
IGL02634:Palm3 APN 8 84028865 missense probably damaging 0.99
IGL02710:Palm3 APN 8 84028312 missense possibly damaging 0.75
R0277:Palm3 UTSW 8 84028720 missense probably damaging 1.00
R0323:Palm3 UTSW 8 84028720 missense probably damaging 1.00
R0422:Palm3 UTSW 8 84028863 missense possibly damaging 0.94
R0507:Palm3 UTSW 8 84028329 missense probably benign 0.00
R0835:Palm3 UTSW 8 84028147 missense probably benign
R1037:Palm3 UTSW 8 84029272 missense probably benign
R1618:Palm3 UTSW 8 84029662 missense possibly damaging 0.92
R1621:Palm3 UTSW 8 84030022 missense possibly damaging 0.93
R1797:Palm3 UTSW 8 84028803 missense probably benign 0.00
R1989:Palm3 UTSW 8 84030022 missense possibly damaging 0.93
R3618:Palm3 UTSW 8 84029344 missense probably benign 0.00
R3619:Palm3 UTSW 8 84029344 missense probably benign 0.00
R4495:Palm3 UTSW 8 84026866 missense probably damaging 1.00
R4588:Palm3 UTSW 8 84029386 missense probably benign 0.20
R4687:Palm3 UTSW 8 84029935 missense probably benign 0.00
R4948:Palm3 UTSW 8 84027079 nonsense probably null
R5265:Palm3 UTSW 8 84021530 critical splice donor site probably null
R5951:Palm3 UTSW 8 84029420 missense probably benign 0.02
R6580:Palm3 UTSW 8 84029548 missense probably damaging 1.00
R7237:Palm3 UTSW 8 84029488 missense probably benign 0.00
R7562:Palm3 UTSW 8 84021507 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- TTCCAGCAGAGATAGCAACAG -3'
(R):5'- TGTCCACCTCAGAGAATGGC -3'

Sequencing Primer
(F):5'- TTCCAGCAGAGATAGCAACAGATGAG -3'
(R):5'- GCTCGATGCCATCTGCC -3'
Posted On2019-11-12