Incidental Mutation 'R7676:Nckipsd'
ID 592459
Institutional Source Beutler Lab
Gene Symbol Nckipsd
Ensembl Gene ENSMUSG00000032598
Gene Name NCK interacting protein with SH3 domain
Synonyms AF3P21, Wasbp, SPIN90, DIP1, WISH, ORF1
MMRRC Submission
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.476) question?
Stock # R7676 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 108808368-108818844 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 108814954 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 525 (F525L)
Ref Sequence ENSEMBL: ENSMUSP00000035218 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035218] [ENSMUST00000194819] [ENSMUST00000195323]
AlphaFold Q9ESJ4
Predicted Effect probably damaging
Transcript: ENSMUST00000035218
AA Change: F525L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000035218
Gene: ENSMUSG00000032598
AA Change: F525L

DomainStartEndE-ValueType
SH3 1 57 2.21e-9 SMART
low complexity region 162 179 N/A INTRINSIC
low complexity region 200 215 N/A INTRINSIC
low complexity region 230 240 N/A INTRINSIC
low complexity region 249 271 N/A INTRINSIC
low complexity region 288 298 N/A INTRINSIC
Pfam:DUF2013 539 675 5e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192678
Predicted Effect probably benign
Transcript: ENSMUST00000194819
SMART Domains Protein: ENSMUSP00000141702
Gene: ENSMUSG00000032598

DomainStartEndE-ValueType
SH3 1 52 3.3e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000195323
SMART Domains Protein: ENSMUSP00000141728
Gene: ENSMUSG00000032598

DomainStartEndE-ValueType
SH3 1 57 1.4e-11 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is localized exclusively in the cell nucleus. It plays a role in signal transduction, and may function in the maintenance of sarcomeres and in the assembly of myofibrils into sarcomeres. It also plays an important role in stress fiber formation. The gene is involved in therapy-related leukemia by a chromosomal translocation t(3;11)(p21;q23) that involves this gene and the myeloid/lymphoid leukemia gene. Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a null mutation exhibit altered protein composition of postsynaptic densities and actin cytoskeleton in hippocampal neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca A G 11: 84,294,987 D116G possibly damaging Het
Adam6a G A 12: 113,544,576 G190S probably benign Het
Adnp G A 2: 168,183,447 R643* probably null Het
Akap6 A G 12: 52,886,850 D375G possibly damaging Het
Aldh1l2 G T 10: 83,508,111 A480E probably benign Het
Ccdc175 T A 12: 72,102,047 Q779L possibly damaging Het
D430042O09Rik A G 7: 125,850,377 D897G probably benign Het
Dnah7b T G 1: 46,234,164 L2484* probably null Het
Dnajc21 T C 15: 10,462,344 Y65C possibly damaging Het
Dnhd1 C A 7: 105,684,087 N255K probably benign Het
Efhc1 G T 1: 20,967,369 G257W probably damaging Het
Fars2 C A 13: 36,205,043 L172I probably benign Het
Fat4 T C 3: 38,891,697 Y1580H probably damaging Het
Fli1 T A 9: 32,428,030 N253Y probably benign Het
Foxd3 G T 4: 99,656,914 C97F probably damaging Het
Gem C A 4: 11,711,170 D120E possibly damaging Het
Ighv10-3 A G 12: 114,523,679 C41R probably damaging Het
Kcnab3 A G 11: 69,326,727 S16G probably benign Het
Keg1 T G 19: 12,716,045 V154G probably benign Het
Lrrc45 G A 11: 120,720,322 R602H probably damaging Het
Ltbp1 A G 17: 75,291,297 D591G possibly damaging Het
Mmp10 T A 9: 7,503,549 V140D probably damaging Het
Nat8f2 A T 6: 85,868,212 M56K probably benign Het
Olfr1328 A G 4: 118,934,150 S233P probably damaging Het
Olfr1406 T A 1: 173,183,553 K294* probably null Het
Olfr804 G T 10: 129,705,286 S136I possibly damaging Het
P2ry12 T A 3: 59,217,757 M166L possibly damaging Het
Palm3 T C 8: 84,029,445 S529P possibly damaging Het
Pdilt A T 7: 119,494,997 Y344N probably damaging Het
Pip4k2b A T 11: 97,720,362 N309K probably benign Het
Pkd1l1 C T 11: 8,962,708 V166I Het
Plxdc2 C T 2: 16,712,083 S377L probably benign Het
Rc3h2 A T 2: 37,405,332 V224E possibly damaging Het
Stk32c T A 7: 139,105,304 D428V possibly damaging Het
Ttn T C 2: 76,814,607 D12968G probably damaging Het
Tulp2 G T 7: 45,521,027 V457F possibly damaging Het
Vcan A T 13: 89,691,789 S1879T probably damaging Het
Vmn1r51 T C 6: 90,129,455 Y118H probably benign Het
Zfat A C 15: 68,224,844 V40G possibly damaging Het
Other mutations in Nckipsd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Nckipsd APN 9 108814969 missense probably benign 0.07
IGL01601:Nckipsd APN 9 108813955 missense probably benign 0.00
IGL01809:Nckipsd APN 9 108817554 missense probably damaging 1.00
IGL03229:Nckipsd APN 9 108811614 missense probably benign
R0714:Nckipsd UTSW 9 108814134 unclassified probably benign
R1323:Nckipsd UTSW 9 108812579 missense probably damaging 1.00
R1323:Nckipsd UTSW 9 108812579 missense probably damaging 1.00
R1543:Nckipsd UTSW 9 108812372 missense possibly damaging 0.62
R1958:Nckipsd UTSW 9 108814664 splice site probably null
R2127:Nckipsd UTSW 9 108811733 missense probably benign
R3697:Nckipsd UTSW 9 108811121 missense probably damaging 1.00
R3698:Nckipsd UTSW 9 108811121 missense probably damaging 1.00
R3921:Nckipsd UTSW 9 108814076 missense possibly damaging 0.81
R4755:Nckipsd UTSW 9 108814739 missense probably benign 0.28
R4879:Nckipsd UTSW 9 108813915 unclassified probably benign
R5796:Nckipsd UTSW 9 108811614 missense probably benign
R5891:Nckipsd UTSW 9 108808609 missense probably damaging 1.00
R5943:Nckipsd UTSW 9 108812236 missense possibly damaging 0.54
R5994:Nckipsd UTSW 9 108813977 missense probably benign 0.00
R6144:Nckipsd UTSW 9 108812386 missense probably damaging 1.00
R6403:Nckipsd UTSW 9 108811683 missense possibly damaging 0.71
R7413:Nckipsd UTSW 9 108814081 missense probably benign 0.30
R7702:Nckipsd UTSW 9 108814017 nonsense probably null
R7893:Nckipsd UTSW 9 108815389 missense probably damaging 1.00
R8257:Nckipsd UTSW 9 108814928 missense probably benign 0.10
R9327:Nckipsd UTSW 9 108814500 missense possibly damaging 0.49
R9353:Nckipsd UTSW 9 108814272 missense probably damaging 0.99
R9484:Nckipsd UTSW 9 108812638 missense probably damaging 1.00
Y4335:Nckipsd UTSW 9 108817545 missense probably damaging 1.00
Z1088:Nckipsd UTSW 9 108814677 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TCAAACCCTAAGCAGTGGGC -3'
(R):5'- CATGATGACATTCTGCTCAGGAG -3'

Sequencing Primer
(F):5'- CACAAGGCCCCAGAGGTAAG -3'
(R):5'- CTCAGGAGCTGCGGAGAGAC -3'
Posted On 2019-11-12