Incidental Mutation 'R7676:Nckipsd'
ID 592459
Institutional Source Beutler Lab
Gene Symbol Nckipsd
Ensembl Gene ENSMUSG00000032598
Gene Name NCK interacting protein with SH3 domain
Synonyms ORF1, DIP1, Wasbp, SPIN90, AF3P21, WISH
MMRRC Submission 045647-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.438) question?
Stock # R7676 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 108685567-108696043 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 108692153 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 525 (F525L)
Ref Sequence ENSEMBL: ENSMUSP00000035218 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035218] [ENSMUST00000194819] [ENSMUST00000195323]
AlphaFold Q9ESJ4
Predicted Effect probably damaging
Transcript: ENSMUST00000035218
AA Change: F525L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000035218
Gene: ENSMUSG00000032598
AA Change: F525L

DomainStartEndE-ValueType
SH3 1 57 2.21e-9 SMART
low complexity region 162 179 N/A INTRINSIC
low complexity region 200 215 N/A INTRINSIC
low complexity region 230 240 N/A INTRINSIC
low complexity region 249 271 N/A INTRINSIC
low complexity region 288 298 N/A INTRINSIC
Pfam:DUF2013 539 675 5e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192678
Predicted Effect probably benign
Transcript: ENSMUST00000194819
SMART Domains Protein: ENSMUSP00000141702
Gene: ENSMUSG00000032598

DomainStartEndE-ValueType
SH3 1 52 3.3e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000195323
SMART Domains Protein: ENSMUSP00000141728
Gene: ENSMUSG00000032598

DomainStartEndE-ValueType
SH3 1 57 1.4e-11 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is localized exclusively in the cell nucleus. It plays a role in signal transduction, and may function in the maintenance of sarcomeres and in the assembly of myofibrils into sarcomeres. It also plays an important role in stress fiber formation. The gene is involved in therapy-related leukemia by a chromosomal translocation t(3;11)(p21;q23) that involves this gene and the myeloid/lymphoid leukemia gene. Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a null mutation exhibit altered protein composition of postsynaptic densities and actin cytoskeleton in hippocampal neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca A G 11: 84,185,813 (GRCm39) D116G possibly damaging Het
Adam6a G A 12: 113,508,196 (GRCm39) G190S probably benign Het
Adnp G A 2: 168,025,367 (GRCm39) R643* probably null Het
Akap6 A G 12: 52,933,633 (GRCm39) D375G possibly damaging Het
Aldh1l2 G T 10: 83,343,975 (GRCm39) A480E probably benign Het
Ccdc175 T A 12: 72,148,821 (GRCm39) Q779L possibly damaging Het
Dnah7b T G 1: 46,273,324 (GRCm39) L2484* probably null Het
Dnajc21 T C 15: 10,462,430 (GRCm39) Y65C possibly damaging Het
Dnhd1 C A 7: 105,333,294 (GRCm39) N255K probably benign Het
Efhc1 G T 1: 21,037,593 (GRCm39) G257W probably damaging Het
Fars2 C A 13: 36,389,026 (GRCm39) L172I probably benign Het
Fat4 T C 3: 38,945,846 (GRCm39) Y1580H probably damaging Het
Fli1 T A 9: 32,339,326 (GRCm39) N253Y probably benign Het
Foxd3 G T 4: 99,545,151 (GRCm39) C97F probably damaging Het
Gem C A 4: 11,711,170 (GRCm39) D120E possibly damaging Het
Ighv10-3 A G 12: 114,487,299 (GRCm39) C41R probably damaging Het
Katnip A G 7: 125,449,549 (GRCm39) D897G probably benign Het
Kcnab3 A G 11: 69,217,553 (GRCm39) S16G probably benign Het
Keg1 T G 19: 12,693,409 (GRCm39) V154G probably benign Het
Lrrc45 G A 11: 120,611,148 (GRCm39) R602H probably damaging Het
Ltbp1 A G 17: 75,598,292 (GRCm39) D591G possibly damaging Het
Mmp10 T A 9: 7,503,550 (GRCm39) V140D probably damaging Het
Nat8f2 A T 6: 85,845,194 (GRCm39) M56K probably benign Het
Or10ak7 A G 4: 118,791,347 (GRCm39) S233P probably damaging Het
Or10j7 T A 1: 173,011,120 (GRCm39) K294* probably null Het
Or6c6c G T 10: 129,541,155 (GRCm39) S136I possibly damaging Het
P2ry12 T A 3: 59,125,178 (GRCm39) M166L possibly damaging Het
Palm3 T C 8: 84,756,074 (GRCm39) S529P possibly damaging Het
Pdilt A T 7: 119,094,220 (GRCm39) Y344N probably damaging Het
Pip4k2b A T 11: 97,611,188 (GRCm39) N309K probably benign Het
Pkd1l1 C T 11: 8,912,708 (GRCm39) V166I Het
Plxdc2 C T 2: 16,716,894 (GRCm39) S377L probably benign Het
Rc3h2 A T 2: 37,295,344 (GRCm39) V224E possibly damaging Het
Stk32c T A 7: 138,685,220 (GRCm39) D428V possibly damaging Het
Ttn T C 2: 76,644,951 (GRCm39) D12968G probably damaging Het
Tulp2 G T 7: 45,170,451 (GRCm39) V457F possibly damaging Het
Vcan A T 13: 89,839,908 (GRCm39) S1879T probably damaging Het
Vmn1r51 T C 6: 90,106,437 (GRCm39) Y118H probably benign Het
Zfat A C 15: 68,096,693 (GRCm39) V40G possibly damaging Het
Other mutations in Nckipsd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Nckipsd APN 9 108,692,168 (GRCm39) missense probably benign 0.07
IGL01601:Nckipsd APN 9 108,691,154 (GRCm39) missense probably benign 0.00
IGL01809:Nckipsd APN 9 108,694,753 (GRCm39) missense probably damaging 1.00
IGL03229:Nckipsd APN 9 108,688,813 (GRCm39) missense probably benign
R0714:Nckipsd UTSW 9 108,691,333 (GRCm39) unclassified probably benign
R1323:Nckipsd UTSW 9 108,689,778 (GRCm39) missense probably damaging 1.00
R1323:Nckipsd UTSW 9 108,689,778 (GRCm39) missense probably damaging 1.00
R1543:Nckipsd UTSW 9 108,689,571 (GRCm39) missense possibly damaging 0.62
R1958:Nckipsd UTSW 9 108,691,863 (GRCm39) splice site probably null
R2127:Nckipsd UTSW 9 108,688,932 (GRCm39) missense probably benign
R3697:Nckipsd UTSW 9 108,688,320 (GRCm39) missense probably damaging 1.00
R3698:Nckipsd UTSW 9 108,688,320 (GRCm39) missense probably damaging 1.00
R3921:Nckipsd UTSW 9 108,691,275 (GRCm39) missense possibly damaging 0.81
R4755:Nckipsd UTSW 9 108,691,938 (GRCm39) missense probably benign 0.28
R4879:Nckipsd UTSW 9 108,691,114 (GRCm39) unclassified probably benign
R5796:Nckipsd UTSW 9 108,688,813 (GRCm39) missense probably benign
R5891:Nckipsd UTSW 9 108,685,808 (GRCm39) missense probably damaging 1.00
R5943:Nckipsd UTSW 9 108,689,435 (GRCm39) missense possibly damaging 0.54
R5994:Nckipsd UTSW 9 108,691,176 (GRCm39) missense probably benign 0.00
R6144:Nckipsd UTSW 9 108,689,585 (GRCm39) missense probably damaging 1.00
R6403:Nckipsd UTSW 9 108,688,882 (GRCm39) missense possibly damaging 0.71
R7413:Nckipsd UTSW 9 108,691,280 (GRCm39) missense probably benign 0.30
R7702:Nckipsd UTSW 9 108,691,216 (GRCm39) nonsense probably null
R7893:Nckipsd UTSW 9 108,692,588 (GRCm39) missense probably damaging 1.00
R8257:Nckipsd UTSW 9 108,692,127 (GRCm39) missense probably benign 0.10
R9327:Nckipsd UTSW 9 108,691,699 (GRCm39) missense possibly damaging 0.49
R9353:Nckipsd UTSW 9 108,691,471 (GRCm39) missense probably damaging 0.99
R9484:Nckipsd UTSW 9 108,689,837 (GRCm39) missense probably damaging 1.00
Y4335:Nckipsd UTSW 9 108,694,744 (GRCm39) missense probably damaging 1.00
Z1088:Nckipsd UTSW 9 108,691,876 (GRCm39) missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TCAAACCCTAAGCAGTGGGC -3'
(R):5'- CATGATGACATTCTGCTCAGGAG -3'

Sequencing Primer
(F):5'- CACAAGGCCCCAGAGGTAAG -3'
(R):5'- CTCAGGAGCTGCGGAGAGAC -3'
Posted On 2019-11-12