Incidental Mutation 'R7676:Olfr804'
ID 592461
Institutional Source Beutler Lab
Gene Symbol Olfr804
Ensembl Gene ENSMUSG00000095401
Gene Name olfactory receptor 804
Synonyms MOR110-7, GA_x6K02T2PULF-11383575-11384519
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.078) question?
Stock # R7676 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 129703210-129710018 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 129705286 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Isoleucine at position 136 (S136I)
Ref Sequence ENSEMBL: ENSMUSP00000150132 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077312] [ENSMUST00000213331]
AlphaFold Q7TRH7
Predicted Effect possibly damaging
Transcript: ENSMUST00000077312
AA Change: S136I

PolyPhen 2 Score 0.630 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000076540
Gene: ENSMUSG00000095401
AA Change: S136I

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 6e-48 PFAM
Pfam:7tm_1 39 288 3.3e-23 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213331
AA Change: S136I

PolyPhen 2 Score 0.630 (Sensitivity: 0.87; Specificity: 0.91)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca A G 11: 84,294,987 D116G possibly damaging Het
Adam6a G A 12: 113,544,576 G190S probably benign Het
Adnp G A 2: 168,183,447 R643* probably null Het
Akap6 A G 12: 52,886,850 D375G possibly damaging Het
Aldh1l2 G T 10: 83,508,111 A480E probably benign Het
Ccdc175 T A 12: 72,102,047 Q779L possibly damaging Het
D430042O09Rik A G 7: 125,850,377 D897G probably benign Het
Dnah7b T G 1: 46,234,164 L2484* probably null Het
Dnajc21 T C 15: 10,462,344 Y65C possibly damaging Het
Dnhd1 C A 7: 105,684,087 N255K probably benign Het
Efhc1 G T 1: 20,967,369 G257W probably damaging Het
Fars2 C A 13: 36,205,043 L172I probably benign Het
Fat4 T C 3: 38,891,697 Y1580H probably damaging Het
Fli1 T A 9: 32,428,030 N253Y probably benign Het
Foxd3 G T 4: 99,656,914 C97F probably damaging Het
Gem C A 4: 11,711,170 D120E possibly damaging Het
Ighv10-3 A G 12: 114,523,679 C41R probably damaging Het
Kcnab3 A G 11: 69,326,727 S16G probably benign Het
Keg1 T G 19: 12,716,045 V154G probably benign Het
Lrrc45 G A 11: 120,720,322 R602H probably damaging Het
Ltbp1 A G 17: 75,291,297 D591G possibly damaging Het
Mmp10 T A 9: 7,503,549 V140D probably damaging Het
Nat8f2 A T 6: 85,868,212 M56K probably benign Het
Nckipsd T C 9: 108,814,954 F525L probably damaging Het
Olfr1328 A G 4: 118,934,150 S233P probably damaging Het
Olfr1406 T A 1: 173,183,553 K294* probably null Het
P2ry12 T A 3: 59,217,757 M166L possibly damaging Het
Palm3 T C 8: 84,029,445 S529P possibly damaging Het
Pdilt A T 7: 119,494,997 Y344N probably damaging Het
Pip4k2b A T 11: 97,720,362 N309K probably benign Het
Pkd1l1 C T 11: 8,962,708 V166I Het
Plxdc2 C T 2: 16,712,083 S377L probably benign Het
Rc3h2 A T 2: 37,405,332 V224E possibly damaging Het
Stk32c T A 7: 139,105,304 D428V possibly damaging Het
Ttn T C 2: 76,814,607 D12968G probably damaging Het
Tulp2 G T 7: 45,521,027 V457F possibly damaging Het
Vcan A T 13: 89,691,789 S1879T probably damaging Het
Vmn1r51 T C 6: 90,129,455 Y118H probably benign Het
Zfat A C 15: 68,224,844 V40G possibly damaging Het
Other mutations in Olfr804
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01613:Olfr804 APN 10 129705623 missense probably benign 0.01
IGL02041:Olfr804 APN 10 129705235 missense probably damaging 1.00
IGL02245:Olfr804 APN 10 129705739 missense probably damaging 1.00
IGL02341:Olfr804 APN 10 129705489 missense probably damaging 0.99
IGL02433:Olfr804 APN 10 129705576 missense probably benign 0.01
authen UTSW 10 129705799 missense probably benign 0.00
R0111:Olfr804 UTSW 10 129705277 missense probably damaging 1.00
R0309:Olfr804 UTSW 10 129705139 missense probably benign 0.38
R0326:Olfr804 UTSW 10 129705769 missense possibly damaging 0.69
R0374:Olfr804 UTSW 10 129705647 missense probably benign 0.00
R1573:Olfr804 UTSW 10 129705618 missense probably damaging 1.00
R1663:Olfr804 UTSW 10 129705291 missense probably benign 0.44
R1778:Olfr804 UTSW 10 129705705 missense probably benign 0.01
R1789:Olfr804 UTSW 10 129705607 missense possibly damaging 0.82
R1906:Olfr804 UTSW 10 129705496 missense probably benign 0.00
R2108:Olfr804 UTSW 10 129705621 missense probably benign
R2211:Olfr804 UTSW 10 129705451 missense probably benign
R2432:Olfr804 UTSW 10 129704925 missense possibly damaging 0.91
R2902:Olfr804 UTSW 10 129705451 missense probably benign
R4114:Olfr804 UTSW 10 129705799 missense probably benign 0.00
R5149:Olfr804 UTSW 10 129705508 missense probably benign 0.00
R5153:Olfr804 UTSW 10 129705157 missense probably benign 0.05
R5846:Olfr804 UTSW 10 129704887 missense probably damaging 0.99
R6553:Olfr804 UTSW 10 129705063 missense probably benign 0.07
R8161:Olfr804 UTSW 10 129704884 missense possibly damaging 0.94
R9266:Olfr804 UTSW 10 129705678 missense probably benign 0.17
R9318:Olfr804 UTSW 10 129705414 missense probably benign 0.00
R9334:Olfr804 UTSW 10 129705814 missense probably benign 0.00
R9746:Olfr804 UTSW 10 129705339 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TGACAGCCATTGTGACTGGAG -3'
(R):5'- CTCACTAGTACCAGTGTGACTACAAG -3'

Sequencing Primer
(F):5'- GTGACTGGAGACAAAACTGTTTC -3'
(R):5'- GTACCAGTGTGACTACAAGTGTCAC -3'
Posted On 2019-11-12