Incidental Mutation 'R7676:Or6c6c'
ID 592461
Institutional Source Beutler Lab
Gene Symbol Or6c6c
Ensembl Gene ENSMUSG00000095401
Gene Name olfactory receptor family 6 subfamily C member 6C
Synonyms GA_x6K02T2PULF-11383575-11384519, MOR110-7, Olfr804
MMRRC Submission 045647-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.090) question?
Stock # R7676 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 129540749-129541693 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 129541155 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Isoleucine at position 136 (S136I)
Ref Sequence ENSEMBL: ENSMUSP00000150132 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077312] [ENSMUST00000213331]
AlphaFold Q7TRH7
Predicted Effect possibly damaging
Transcript: ENSMUST00000077312
AA Change: S136I

PolyPhen 2 Score 0.630 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000076540
Gene: ENSMUSG00000095401
AA Change: S136I

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 6e-48 PFAM
Pfam:7tm_1 39 288 3.3e-23 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213331
AA Change: S136I

PolyPhen 2 Score 0.630 (Sensitivity: 0.87; Specificity: 0.91)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca A G 11: 84,185,813 (GRCm39) D116G possibly damaging Het
Adam6a G A 12: 113,508,196 (GRCm39) G190S probably benign Het
Adnp G A 2: 168,025,367 (GRCm39) R643* probably null Het
Akap6 A G 12: 52,933,633 (GRCm39) D375G possibly damaging Het
Aldh1l2 G T 10: 83,343,975 (GRCm39) A480E probably benign Het
Ccdc175 T A 12: 72,148,821 (GRCm39) Q779L possibly damaging Het
Dnah7b T G 1: 46,273,324 (GRCm39) L2484* probably null Het
Dnajc21 T C 15: 10,462,430 (GRCm39) Y65C possibly damaging Het
Dnhd1 C A 7: 105,333,294 (GRCm39) N255K probably benign Het
Efhc1 G T 1: 21,037,593 (GRCm39) G257W probably damaging Het
Fars2 C A 13: 36,389,026 (GRCm39) L172I probably benign Het
Fat4 T C 3: 38,945,846 (GRCm39) Y1580H probably damaging Het
Fli1 T A 9: 32,339,326 (GRCm39) N253Y probably benign Het
Foxd3 G T 4: 99,545,151 (GRCm39) C97F probably damaging Het
Gem C A 4: 11,711,170 (GRCm39) D120E possibly damaging Het
Ighv10-3 A G 12: 114,487,299 (GRCm39) C41R probably damaging Het
Katnip A G 7: 125,449,549 (GRCm39) D897G probably benign Het
Kcnab3 A G 11: 69,217,553 (GRCm39) S16G probably benign Het
Keg1 T G 19: 12,693,409 (GRCm39) V154G probably benign Het
Lrrc45 G A 11: 120,611,148 (GRCm39) R602H probably damaging Het
Ltbp1 A G 17: 75,598,292 (GRCm39) D591G possibly damaging Het
Mmp10 T A 9: 7,503,550 (GRCm39) V140D probably damaging Het
Nat8f2 A T 6: 85,845,194 (GRCm39) M56K probably benign Het
Nckipsd T C 9: 108,692,153 (GRCm39) F525L probably damaging Het
Or10ak7 A G 4: 118,791,347 (GRCm39) S233P probably damaging Het
Or10j7 T A 1: 173,011,120 (GRCm39) K294* probably null Het
P2ry12 T A 3: 59,125,178 (GRCm39) M166L possibly damaging Het
Palm3 T C 8: 84,756,074 (GRCm39) S529P possibly damaging Het
Pdilt A T 7: 119,094,220 (GRCm39) Y344N probably damaging Het
Pip4k2b A T 11: 97,611,188 (GRCm39) N309K probably benign Het
Pkd1l1 C T 11: 8,912,708 (GRCm39) V166I Het
Plxdc2 C T 2: 16,716,894 (GRCm39) S377L probably benign Het
Rc3h2 A T 2: 37,295,344 (GRCm39) V224E possibly damaging Het
Stk32c T A 7: 138,685,220 (GRCm39) D428V possibly damaging Het
Ttn T C 2: 76,644,951 (GRCm39) D12968G probably damaging Het
Tulp2 G T 7: 45,170,451 (GRCm39) V457F possibly damaging Het
Vcan A T 13: 89,839,908 (GRCm39) S1879T probably damaging Het
Vmn1r51 T C 6: 90,106,437 (GRCm39) Y118H probably benign Het
Zfat A C 15: 68,096,693 (GRCm39) V40G possibly damaging Het
Other mutations in Or6c6c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01613:Or6c6c APN 10 129,541,492 (GRCm39) missense probably benign 0.01
IGL02041:Or6c6c APN 10 129,541,104 (GRCm39) missense probably damaging 1.00
IGL02245:Or6c6c APN 10 129,541,608 (GRCm39) missense probably damaging 1.00
IGL02341:Or6c6c APN 10 129,541,358 (GRCm39) missense probably damaging 0.99
IGL02433:Or6c6c APN 10 129,541,445 (GRCm39) missense probably benign 0.01
authen UTSW 10 129,541,668 (GRCm39) missense probably benign 0.00
R0111:Or6c6c UTSW 10 129,541,146 (GRCm39) missense probably damaging 1.00
R0309:Or6c6c UTSW 10 129,541,008 (GRCm39) missense probably benign 0.38
R0326:Or6c6c UTSW 10 129,541,638 (GRCm39) missense possibly damaging 0.69
R0374:Or6c6c UTSW 10 129,541,516 (GRCm39) missense probably benign 0.00
R1573:Or6c6c UTSW 10 129,541,487 (GRCm39) missense probably damaging 1.00
R1663:Or6c6c UTSW 10 129,541,160 (GRCm39) missense probably benign 0.44
R1778:Or6c6c UTSW 10 129,541,574 (GRCm39) missense probably benign 0.01
R1789:Or6c6c UTSW 10 129,541,476 (GRCm39) missense possibly damaging 0.82
R1906:Or6c6c UTSW 10 129,541,365 (GRCm39) missense probably benign 0.00
R2108:Or6c6c UTSW 10 129,541,490 (GRCm39) missense probably benign
R2211:Or6c6c UTSW 10 129,541,320 (GRCm39) missense probably benign
R2432:Or6c6c UTSW 10 129,540,794 (GRCm39) missense possibly damaging 0.91
R2902:Or6c6c UTSW 10 129,541,320 (GRCm39) missense probably benign
R4114:Or6c6c UTSW 10 129,541,668 (GRCm39) missense probably benign 0.00
R5149:Or6c6c UTSW 10 129,541,377 (GRCm39) missense probably benign 0.00
R5153:Or6c6c UTSW 10 129,541,026 (GRCm39) missense probably benign 0.05
R5846:Or6c6c UTSW 10 129,540,756 (GRCm39) missense probably damaging 0.99
R6553:Or6c6c UTSW 10 129,540,932 (GRCm39) missense probably benign 0.07
R8161:Or6c6c UTSW 10 129,540,753 (GRCm39) missense possibly damaging 0.94
R9266:Or6c6c UTSW 10 129,541,547 (GRCm39) missense probably benign 0.17
R9318:Or6c6c UTSW 10 129,541,283 (GRCm39) missense probably benign 0.00
R9334:Or6c6c UTSW 10 129,541,683 (GRCm39) missense probably benign 0.00
R9746:Or6c6c UTSW 10 129,541,208 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TGACAGCCATTGTGACTGGAG -3'
(R):5'- CTCACTAGTACCAGTGTGACTACAAG -3'

Sequencing Primer
(F):5'- GTGACTGGAGACAAAACTGTTTC -3'
(R):5'- GTACCAGTGTGACTACAAGTGTCAC -3'
Posted On 2019-11-12