Mutagenetix > Incidental Mutations

Incidental Mutation 'R7676:Pkd1l1'

592462

Institutional Source

Beutler Lab

Gene Symbol

Pkd1l1

Ensembl Gene

ENSMUSG00000046634

Gene Name

polycystic kidney disease 1 like 1

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7676 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

8826708-8973266 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 8962708 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 166 (V166I)

Gene Model

predicted gene model for transcript(s):

AlphaFold

no structure available at present

Predicted Effect

SMART Domains

Protein: ENSMUSP00000120803
Gene: ENSMUSG00000046634
AA Change: V166I

Domain	Start	End	E-Value	Type
low complexity region	172	184	N/A	INTRINSIC
PKD	205	287	2.9e0	SMART
PKD	291	369	1.42e-9	SMART
Pfam:REJ	398	1001	1.7e-45	PFAM
low complexity region	1208	1218	N/A	INTRINSIC
GPS	1370	1413	1.21e-1	SMART
transmembrane domain	1434	1451	N/A	INTRINSIC
LH2	1479	1598	2.94e-3	SMART
transmembrane domain	1640	1659	N/A	INTRINSIC
transmembrane domain	1679	1701	N/A	INTRINSIC
transmembrane domain	1817	1839	N/A	INTRINSIC
transmembrane domain	1854	1876	N/A	INTRINSIC
Pfam:PKD_channel	2109	2339	1.5e-23	PFAM
transmembrane domain	2381	2403	N/A	INTRINSIC
low complexity region	2436	2449	N/A	INTRINSIC
low complexity region	2458	2469	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the polycystin protein family containing 11 transmembrane domains, a receptor for egg jelly (REJ) domain, and a polycystin-1, lipoxygenase, alpha-toxin (PLAT) domain. The encoded protein may play a role in the male reproductive system. Alternative splice variants have been described but their biological nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU induced point mutation display lethality throughout fetal growth and development with abnormalities in left right patterning and heterotaxia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acaca	A	G	11: 84,294,987	D116G	possibly damaging	Het
Adam6a	G	A	12: 113,544,576	G190S	probably benign	Het
Adnp	G	A	2: 168,183,447	R643*	probably null	Het
Akap6	A	G	12: 52,886,850	D375G	possibly damaging	Het
Aldh1l2	G	T	10: 83,508,111	A480E	probably benign	Het
Ccdc175	T	A	12: 72,102,047	Q779L	possibly damaging	Het
D430042O09Rik	A	G	7: 125,850,377	D897G	probably benign	Het
Dnah7b	T	G	1: 46,234,164	L2484*	probably null	Het
Dnajc21	T	C	15: 10,462,344	Y65C	possibly damaging	Het
Dnhd1	C	A	7: 105,684,087	N255K	probably benign	Het
Efhc1	G	T	1: 20,967,369	G257W	probably damaging	Het
Fars2	C	A	13: 36,205,043	L172I	probably benign	Het
Fat4	T	C	3: 38,891,697	Y1580H	probably damaging	Het
Fli1	T	A	9: 32,428,030	N253Y	probably benign	Het
Foxd3	G	T	4: 99,656,914	C97F	probably damaging	Het
Gem	C	A	4: 11,711,170	D120E	possibly damaging	Het
Ighv10-3	A	G	12: 114,523,679	C41R	probably damaging	Het
Kcnab3	A	G	11: 69,326,727	S16G	probably benign	Het
Keg1	T	G	19: 12,716,045	V154G	probably benign	Het
Lrrc45	G	A	11: 120,720,322	R602H	probably damaging	Het
Ltbp1	A	G	17: 75,291,297	D591G	possibly damaging	Het
Mmp10	T	A	9: 7,503,549	V140D	probably damaging	Het
Nat8f2	A	T	6: 85,868,212	M56K	probably benign	Het
Nckipsd	T	C	9: 108,814,954	F525L	probably damaging	Het
Olfr1328	A	G	4: 118,934,150	S233P	probably damaging	Het
Olfr1406	T	A	1: 173,183,553	K294*	probably null	Het
Olfr804	G	T	10: 129,705,286	S136I	possibly damaging	Het
P2ry12	T	A	3: 59,217,757	M166L	possibly damaging	Het
Palm3	T	C	8: 84,029,445	S529P	possibly damaging	Het
Pdilt	A	T	7: 119,494,997	Y344N	probably damaging	Het
Pip4k2b	A	T	11: 97,720,362	N309K	probably benign	Het
Plxdc2	C	T	2: 16,712,083	S377L	probably benign	Het
Rc3h2	A	T	2: 37,405,332	V224E	possibly damaging	Het
Stk32c	T	A	7: 139,105,304	D428V	possibly damaging	Het
Ttn	T	C	2: 76,814,607	D12968G	probably damaging	Het
Tulp2	G	T	7: 45,521,027	V457F	possibly damaging	Het
Vcan	A	T	13: 89,691,789	S1879T	probably damaging	Het
Vmn1r51	T	C	6: 90,129,455	Y118H	probably benign	Het
Zfat	A	C	15: 68,224,844	V40G	possibly damaging	Het

Other mutations in Pkd1l1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00093:Pkd1l1	APN	11	8961971	missense	unknown
IGL00156:Pkd1l1	APN	11	8950515	missense	probably damaging	1.00
IGL00161:Pkd1l1	APN	11	8929353	critical splice donor site	probably null
IGL00489:Pkd1l1	APN	11	8834773	critical splice donor site	probably null
IGL00495:Pkd1l1	APN	11	8868493	missense	probably benign	0.34
IGL00983:Pkd1l1	APN	11	8844585	missense	probably benign
IGL01071:Pkd1l1	APN	11	8848921	missense	probably benign	0.00
IGL01093:Pkd1l1	APN	11	8901345	missense	probably benign	0.06
IGL01295:Pkd1l1	APN	11	8933685	missense	possibly damaging	0.93
IGL01311:Pkd1l1	APN	11	8901174	missense	possibly damaging	0.53
IGL01412:Pkd1l1	APN	11	8950409	missense	possibly damaging	0.73
IGL01978:Pkd1l1	APN	11	8961336	missense	unknown
IGL01999:Pkd1l1	APN	11	8836291	missense	probably benign
IGL02080:Pkd1l1	APN	11	8961345	missense	unknown
IGL02106:Pkd1l1	APN	11	8833800	missense	probably damaging	1.00
IGL02216:Pkd1l1	APN	11	8834897	missense	probably damaging	0.96
IGL02305:Pkd1l1	APN	11	8902467	missense	probably benign
IGL02337:Pkd1l1	APN	11	8942079	missense	probably damaging	1.00
IGL02576:Pkd1l1	APN	11	8844560	missense	possibly damaging	0.61
IGL02704:Pkd1l1	APN	11	8834910	missense	probably benign	0.00
IGL02814:Pkd1l1	APN	11	8902582	missense	probably benign	0.01
IGL02904:Pkd1l1	APN	11	8868450	splice site	probably benign
IGL02972:Pkd1l1	APN	11	8863908	missense	probably damaging	0.99
IGL03091:Pkd1l1	APN	11	8855564	missense	probably damaging	1.00
IGL03113:Pkd1l1	APN	11	8834793	missense	probably benign	0.20
IGL03210:Pkd1l1	APN	11	8965127	missense	unknown
PIT4581001:Pkd1l1	UTSW	11	8916298	frame shift	probably null
R0020:Pkd1l1	UTSW	11	8875765	splice site	probably benign
R0020:Pkd1l1	UTSW	11	8875765	splice site	probably benign
R0496:Pkd1l1	UTSW	11	8929430	missense	probably damaging	0.96
R0547:Pkd1l1	UTSW	11	8836448	splice site	probably benign
R0582:Pkd1l1	UTSW	11	8931699	splice site	probably benign
R0761:Pkd1l1	UTSW	11	8854375	missense	probably damaging	1.00
R0969:Pkd1l1	UTSW	11	8936898	missense	probably damaging	1.00
R1348:Pkd1l1	UTSW	11	8834806	missense	probably benign	0.18
R1366:Pkd1l1	UTSW	11	8941038	splice site	probably benign
R1401:Pkd1l1	UTSW	11	8854487	nonsense	probably null
R1444:Pkd1l1	UTSW	11	8854386	missense	probably damaging	1.00
R1445:Pkd1l1	UTSW	11	8870313	missense	probably benign	0.00
R1463:Pkd1l1	UTSW	11	8916302	missense	probably damaging	1.00
R1496:Pkd1l1	UTSW	11	8941077	missense	possibly damaging	0.95
R1542:Pkd1l1	UTSW	11	8874179	missense	possibly damaging	0.82
R1543:Pkd1l1	UTSW	11	8901200	missense	probably damaging	1.00
R1619:Pkd1l1	UTSW	11	8950413	missense	probably damaging	0.98
R1875:Pkd1l1	UTSW	11	8844670	splice site	probably benign
R1929:Pkd1l1	UTSW	11	8836197	splice site	probably benign
R1958:Pkd1l1	UTSW	11	8874161	missense	probably benign	0.01
R2223:Pkd1l1	UTSW	11	8889063	missense	probably benign	0.18
R2223:Pkd1l1	UTSW	11	8950422	missense	probably benign
R2264:Pkd1l1	UTSW	11	8879112	missense	probably damaging	0.97
R2349:Pkd1l1	UTSW	11	8826819	splice site	probably null
R2431:Pkd1l1	UTSW	11	8947197	missense	probably damaging	0.99
R2483:Pkd1l1	UTSW	11	8962701	missense	probably damaging	1.00
R2517:Pkd1l1	UTSW	11	8958900	missense	unknown
R2888:Pkd1l1	UTSW	11	8947251	missense	probably damaging	1.00
R2965:Pkd1l1	UTSW	11	8874236	missense	probably damaging	1.00
R3123:Pkd1l1	UTSW	11	8973021	missense	unknown
R3153:Pkd1l1	UTSW	11	8867207	missense	probably benign	0.01
R3840:Pkd1l1	UTSW	11	8889050	missense	probably damaging	1.00
R3855:Pkd1l1	UTSW	11	8965047	critical splice donor site	probably null
R3880:Pkd1l1	UTSW	11	8961983	missense	unknown
R3970:Pkd1l1	UTSW	11	8874218	missense	probably damaging	1.00
R4195:Pkd1l1	UTSW	11	8909929	missense	probably damaging	1.00
R4196:Pkd1l1	UTSW	11	8909929	missense	probably damaging	1.00
R4246:Pkd1l1	UTSW	11	8865543	missense	possibly damaging	0.51
R4247:Pkd1l1	UTSW	11	8865543	missense	possibly damaging	0.51
R4249:Pkd1l1	UTSW	11	8865543	missense	possibly damaging	0.51
R4250:Pkd1l1	UTSW	11	8865543	missense	possibly damaging	0.51
R4593:Pkd1l1	UTSW	11	8901253	missense	probably damaging	0.97
R4609:Pkd1l1	UTSW	11	8958964	missense	unknown
R4797:Pkd1l1	UTSW	11	8961340	missense	unknown
R4910:Pkd1l1	UTSW	11	8929360	missense	possibly damaging	0.50
R4940:Pkd1l1	UTSW	11	8844585	missense	probably benign
R5084:Pkd1l1	UTSW	11	8942004	missense	probably benign	0.05
R5147:Pkd1l1	UTSW	11	8849003	missense	possibly damaging	0.71
R5360:Pkd1l1	UTSW	11	8879204	missense	probably benign
R5483:Pkd1l1	UTSW	11	8901141	critical splice donor site	probably null
R5604:Pkd1l1	UTSW	11	8833877	missense	probably damaging	0.98
R5642:Pkd1l1	UTSW	11	8879202	missense	probably damaging	1.00
R5652:Pkd1l1	UTSW	11	8909889	missense	probably benign	0.03
R5751:Pkd1l1	UTSW	11	8867204	missense	possibly damaging	0.45
R5761:Pkd1l1	UTSW	11	8916301	missense	probably damaging	1.00
R5800:Pkd1l1	UTSW	11	8861302	missense	probably benign
R5874:Pkd1l1	UTSW	11	8908688	missense	probably damaging	1.00
R5897:Pkd1l1	UTSW	11	8879176	missense	probably benign	0.03
R5913:Pkd1l1	UTSW	11	8863849	missense	probably benign	0.00
R5930:Pkd1l1	UTSW	11	8958969	missense	unknown
R6000:Pkd1l1	UTSW	11	8950427	missense	probably benign	0.00
R6005:Pkd1l1	UTSW	11	8857113	missense	probably damaging	1.00
R6013:Pkd1l1	UTSW	11	8869452	splice site	probably null
R6027:Pkd1l1	UTSW	11	8916272	nonsense	probably null
R6028:Pkd1l1	UTSW	11	8836267	missense	probably benign	0.06
R6129:Pkd1l1	UTSW	11	8868543	missense	probably benign	0.00
R6182:Pkd1l1	UTSW	11	8865555	missense	probably benign	0.36
R6226:Pkd1l1	UTSW	11	8901287	missense	probably benign	0.00
R6257:Pkd1l1	UTSW	11	8942195	missense	probably benign	0.22
R6340:Pkd1l1	UTSW	11	8844649	missense	probably benign	0.09
R6478:Pkd1l1	UTSW	11	8863911	missense	probably benign	0.00
R6558:Pkd1l1	UTSW	11	8889052	missense	probably benign	0.00
R6750:Pkd1l1	UTSW	11	8973217	missense	unknown
R6987:Pkd1l1	UTSW	11	8902575	missense	probably benign	0.01
R6996:Pkd1l1	UTSW	11	8849046	missense	probably damaging	1.00
R7139:Pkd1l1	UTSW	11	8890737	missense
R7224:Pkd1l1	UTSW	11	8945241	missense
R7244:Pkd1l1	UTSW	11	8871771	missense
R7265:Pkd1l1	UTSW	11	8929402	missense
R7358:Pkd1l1	UTSW	11	8945202	missense
R7387:Pkd1l1	UTSW	11	8901203	missense
R7414:Pkd1l1	UTSW	11	8916267	missense
R7459:Pkd1l1	UTSW	11	8902428	missense
R7478:Pkd1l1	UTSW	11	8929441	missense
R7485:Pkd1l1	UTSW	11	8965148	missense
R7490:Pkd1l1	UTSW	11	8916265	missense
R7644:Pkd1l1	UTSW	11	8875758	missense
R7647:Pkd1l1	UTSW	11	8947296	missense
R7687:Pkd1l1	UTSW	11	8854390	missense
R7699:Pkd1l1	UTSW	11	8965142	missense
R7922:Pkd1l1	UTSW	11	8849013	missense
R7922:Pkd1l1	UTSW	11	8909857	missense
R7980:Pkd1l1	UTSW	11	8854375	missense	probably damaging	1.00
R7993:Pkd1l1	UTSW	11	8945262	missense
R8052:Pkd1l1	UTSW	11	8947315	missense
R8125:Pkd1l1	UTSW	11	8947241	missense	probably damaging	1.00
R8420:Pkd1l1	UTSW	11	8870277	nonsense	probably null
R8675:Pkd1l1	UTSW	11	8848916	critical splice donor site	probably null
R8683:Pkd1l1	UTSW	11	8871805	missense
R8709:Pkd1l1	UTSW	11	8855567	missense
R8711:Pkd1l1	UTSW	11	8865550	missense
R8725:Pkd1l1	UTSW	11	8961482	missense
R8733:Pkd1l1	UTSW	11	8933657	missense
R8822:Pkd1l1	UTSW	11	8856312	missense
R8871:Pkd1l1	UTSW	11	8950503	missense
R9009:Pkd1l1	UTSW	11	8931552	missense
R9099:Pkd1l1	UTSW	11	8972986	missense
R9119:Pkd1l1	UTSW	11	8879107	missense
R9150:Pkd1l1	UTSW	11	8836256	missense
R9314:Pkd1l1	UTSW	11	8879153	missense
R9341:Pkd1l1	UTSW	11	8836399	missense
R9341:Pkd1l1	UTSW	11	8961305	missense
R9343:Pkd1l1	UTSW	11	8836399	missense
R9343:Pkd1l1	UTSW	11	8961305	missense
R9392:Pkd1l1	UTSW	11	8844567	missense
R9424:Pkd1l1	UTSW	11	8870091	missense
X0024:Pkd1l1	UTSW	11	8950413	missense	probably benign	0.01
X0063:Pkd1l1	UTSW	11	8929430	missense	probably damaging	0.96
X0065:Pkd1l1	UTSW	11	8909921	missense	probably benign	0.10
Z1176:Pkd1l1	UTSW	11	8826801	missense
Z1177:Pkd1l1	UTSW	11	8945208	missense

Predicted Primers

PCR Primer
(F):5'- GCCTCAGCAATAGACCACTG -3'
(R):5'- AATTTAAAGAGAGAAACCCTGTGCC -3'

Sequencing Primer
(F):5'- CCACTGAGGGGGTAGAACTACATC -3'
(R):5'- CCAGCTACACCATTTAAGTGTATGC -3'

Posted On

2019-11-12