Incidental Mutation 'R7676:Pkd1l1'
ID 592462
Institutional Source Beutler Lab
Gene Symbol Pkd1l1
Ensembl Gene ENSMUSG00000046634
Gene Name polycystic kidney disease 1 like 1
Synonyms
MMRRC Submission 045647-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7676 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 8826708-8973266 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 8962708 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 166 (V166I)
Gene Model predicted gene model for transcript(s):
AlphaFold no structure available at present
Predicted Effect
SMART Domains Protein: ENSMUSP00000120803
Gene: ENSMUSG00000046634
AA Change: V166I

DomainStartEndE-ValueType
low complexity region 172 184 N/A INTRINSIC
PKD 205 287 2.9e0 SMART
PKD 291 369 1.42e-9 SMART
Pfam:REJ 398 1001 1.7e-45 PFAM
low complexity region 1208 1218 N/A INTRINSIC
GPS 1370 1413 1.21e-1 SMART
transmembrane domain 1434 1451 N/A INTRINSIC
LH2 1479 1598 2.94e-3 SMART
transmembrane domain 1640 1659 N/A INTRINSIC
transmembrane domain 1679 1701 N/A INTRINSIC
transmembrane domain 1817 1839 N/A INTRINSIC
transmembrane domain 1854 1876 N/A INTRINSIC
Pfam:PKD_channel 2109 2339 1.5e-23 PFAM
transmembrane domain 2381 2403 N/A INTRINSIC
low complexity region 2436 2449 N/A INTRINSIC
low complexity region 2458 2469 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the polycystin protein family containing 11 transmembrane domains, a receptor for egg jelly (REJ) domain, and a polycystin-1, lipoxygenase, alpha-toxin (PLAT) domain. The encoded protein may play a role in the male reproductive system. Alternative splice variants have been described but their biological nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU induced point mutation display lethality throughout fetal growth and development with abnormalities in left right patterning and heterotaxia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca A G 11: 84,294,987 (GRCm38) D116G possibly damaging Het
Adam6a G A 12: 113,544,576 (GRCm38) G190S probably benign Het
Adnp G A 2: 168,183,447 (GRCm38) R643* probably null Het
Akap6 A G 12: 52,886,850 (GRCm38) D375G possibly damaging Het
Aldh1l2 G T 10: 83,508,111 (GRCm38) A480E probably benign Het
Ccdc175 T A 12: 72,102,047 (GRCm38) Q779L possibly damaging Het
D430042O09Rik A G 7: 125,850,377 (GRCm38) D897G probably benign Het
Dnah7b T G 1: 46,234,164 (GRCm38) L2484* probably null Het
Dnajc21 T C 15: 10,462,344 (GRCm38) Y65C possibly damaging Het
Dnhd1 C A 7: 105,684,087 (GRCm38) N255K probably benign Het
Efhc1 G T 1: 20,967,369 (GRCm38) G257W probably damaging Het
Fars2 C A 13: 36,205,043 (GRCm38) L172I probably benign Het
Fat4 T C 3: 38,891,697 (GRCm38) Y1580H probably damaging Het
Fli1 T A 9: 32,428,030 (GRCm38) N253Y probably benign Het
Foxd3 G T 4: 99,656,914 (GRCm38) C97F probably damaging Het
Gem C A 4: 11,711,170 (GRCm38) D120E possibly damaging Het
Ighv10-3 A G 12: 114,523,679 (GRCm38) C41R probably damaging Het
Kcnab3 A G 11: 69,326,727 (GRCm38) S16G probably benign Het
Keg1 T G 19: 12,716,045 (GRCm38) V154G probably benign Het
Lrrc45 G A 11: 120,720,322 (GRCm38) R602H probably damaging Het
Ltbp1 A G 17: 75,291,297 (GRCm38) D591G possibly damaging Het
Mmp10 T A 9: 7,503,549 (GRCm38) V140D probably damaging Het
Nat8f2 A T 6: 85,868,212 (GRCm38) M56K probably benign Het
Nckipsd T C 9: 108,814,954 (GRCm38) F525L probably damaging Het
Olfr1328 A G 4: 118,934,150 (GRCm38) S233P probably damaging Het
Olfr1406 T A 1: 173,183,553 (GRCm38) K294* probably null Het
Olfr804 G T 10: 129,705,286 (GRCm38) S136I possibly damaging Het
P2ry12 T A 3: 59,217,757 (GRCm38) M166L possibly damaging Het
Palm3 T C 8: 84,029,445 (GRCm38) S529P possibly damaging Het
Pdilt A T 7: 119,494,997 (GRCm38) Y344N probably damaging Het
Pip4k2b A T 11: 97,720,362 (GRCm38) N309K probably benign Het
Plxdc2 C T 2: 16,712,083 (GRCm38) S377L probably benign Het
Rc3h2 A T 2: 37,405,332 (GRCm38) V224E possibly damaging Het
Stk32c T A 7: 139,105,304 (GRCm38) D428V possibly damaging Het
Ttn T C 2: 76,814,607 (GRCm38) D12968G probably damaging Het
Tulp2 G T 7: 45,521,027 (GRCm38) V457F possibly damaging Het
Vcan A T 13: 89,691,789 (GRCm38) S1879T probably damaging Het
Vmn1r51 T C 6: 90,129,455 (GRCm38) Y118H probably benign Het
Zfat A C 15: 68,224,844 (GRCm38) V40G possibly damaging Het
Other mutations in Pkd1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Pkd1l1 APN 11 8,961,971 (GRCm38) missense unknown
IGL00156:Pkd1l1 APN 11 8,950,515 (GRCm38) missense probably damaging 1.00
IGL00161:Pkd1l1 APN 11 8,929,353 (GRCm38) critical splice donor site probably null
IGL00489:Pkd1l1 APN 11 8,834,773 (GRCm38) critical splice donor site probably null
IGL00495:Pkd1l1 APN 11 8,868,493 (GRCm38) missense probably benign 0.34
IGL00983:Pkd1l1 APN 11 8,844,585 (GRCm38) missense probably benign
IGL01071:Pkd1l1 APN 11 8,848,921 (GRCm38) missense probably benign 0.00
IGL01093:Pkd1l1 APN 11 8,901,345 (GRCm38) missense probably benign 0.06
IGL01295:Pkd1l1 APN 11 8,933,685 (GRCm38) missense possibly damaging 0.93
IGL01311:Pkd1l1 APN 11 8,901,174 (GRCm38) missense possibly damaging 0.53
IGL01412:Pkd1l1 APN 11 8,950,409 (GRCm38) missense possibly damaging 0.73
IGL01978:Pkd1l1 APN 11 8,961,336 (GRCm38) missense unknown
IGL01999:Pkd1l1 APN 11 8,836,291 (GRCm38) missense probably benign
IGL02080:Pkd1l1 APN 11 8,961,345 (GRCm38) missense unknown
IGL02106:Pkd1l1 APN 11 8,833,800 (GRCm38) missense probably damaging 1.00
IGL02216:Pkd1l1 APN 11 8,834,897 (GRCm38) missense probably damaging 0.96
IGL02305:Pkd1l1 APN 11 8,902,467 (GRCm38) missense probably benign
IGL02337:Pkd1l1 APN 11 8,942,079 (GRCm38) missense probably damaging 1.00
IGL02576:Pkd1l1 APN 11 8,844,560 (GRCm38) missense possibly damaging 0.61
IGL02704:Pkd1l1 APN 11 8,834,910 (GRCm38) missense probably benign 0.00
IGL02814:Pkd1l1 APN 11 8,902,582 (GRCm38) missense probably benign 0.01
IGL02904:Pkd1l1 APN 11 8,868,450 (GRCm38) splice site probably benign
IGL02972:Pkd1l1 APN 11 8,863,908 (GRCm38) missense probably damaging 0.99
IGL03091:Pkd1l1 APN 11 8,855,564 (GRCm38) missense probably damaging 1.00
IGL03113:Pkd1l1 APN 11 8,834,793 (GRCm38) missense probably benign 0.20
IGL03210:Pkd1l1 APN 11 8,965,127 (GRCm38) missense unknown
PIT4581001:Pkd1l1 UTSW 11 8,916,298 (GRCm38) frame shift probably null
R0020:Pkd1l1 UTSW 11 8,875,765 (GRCm38) splice site probably benign
R0020:Pkd1l1 UTSW 11 8,875,765 (GRCm38) splice site probably benign
R0496:Pkd1l1 UTSW 11 8,929,430 (GRCm38) missense probably damaging 0.96
R0547:Pkd1l1 UTSW 11 8,836,448 (GRCm38) splice site probably benign
R0582:Pkd1l1 UTSW 11 8,931,699 (GRCm38) splice site probably benign
R0761:Pkd1l1 UTSW 11 8,854,375 (GRCm38) missense probably damaging 1.00
R0969:Pkd1l1 UTSW 11 8,936,898 (GRCm38) missense probably damaging 1.00
R1348:Pkd1l1 UTSW 11 8,834,806 (GRCm38) missense probably benign 0.18
R1366:Pkd1l1 UTSW 11 8,941,038 (GRCm38) splice site probably benign
R1401:Pkd1l1 UTSW 11 8,854,487 (GRCm38) nonsense probably null
R1444:Pkd1l1 UTSW 11 8,854,386 (GRCm38) missense probably damaging 1.00
R1445:Pkd1l1 UTSW 11 8,870,313 (GRCm38) missense probably benign 0.00
R1463:Pkd1l1 UTSW 11 8,916,302 (GRCm38) missense probably damaging 1.00
R1496:Pkd1l1 UTSW 11 8,941,077 (GRCm38) missense possibly damaging 0.95
R1542:Pkd1l1 UTSW 11 8,874,179 (GRCm38) missense possibly damaging 0.82
R1543:Pkd1l1 UTSW 11 8,901,200 (GRCm38) missense probably damaging 1.00
R1619:Pkd1l1 UTSW 11 8,950,413 (GRCm38) missense probably damaging 0.98
R1875:Pkd1l1 UTSW 11 8,844,670 (GRCm38) splice site probably benign
R1929:Pkd1l1 UTSW 11 8,836,197 (GRCm38) splice site probably benign
R1958:Pkd1l1 UTSW 11 8,874,161 (GRCm38) missense probably benign 0.01
R2223:Pkd1l1 UTSW 11 8,950,422 (GRCm38) missense probably benign
R2223:Pkd1l1 UTSW 11 8,889,063 (GRCm38) missense probably benign 0.18
R2264:Pkd1l1 UTSW 11 8,879,112 (GRCm38) missense probably damaging 0.97
R2349:Pkd1l1 UTSW 11 8,826,819 (GRCm38) splice site probably null
R2431:Pkd1l1 UTSW 11 8,947,197 (GRCm38) missense probably damaging 0.99
R2483:Pkd1l1 UTSW 11 8,962,701 (GRCm38) missense probably damaging 1.00
R2517:Pkd1l1 UTSW 11 8,958,900 (GRCm38) missense unknown
R2888:Pkd1l1 UTSW 11 8,947,251 (GRCm38) missense probably damaging 1.00
R2965:Pkd1l1 UTSW 11 8,874,236 (GRCm38) missense probably damaging 1.00
R3123:Pkd1l1 UTSW 11 8,973,021 (GRCm38) missense unknown
R3153:Pkd1l1 UTSW 11 8,867,207 (GRCm38) missense probably benign 0.01
R3840:Pkd1l1 UTSW 11 8,889,050 (GRCm38) missense probably damaging 1.00
R3855:Pkd1l1 UTSW 11 8,965,047 (GRCm38) critical splice donor site probably null
R3880:Pkd1l1 UTSW 11 8,961,983 (GRCm38) missense unknown
R3970:Pkd1l1 UTSW 11 8,874,218 (GRCm38) missense probably damaging 1.00
R4195:Pkd1l1 UTSW 11 8,909,929 (GRCm38) missense probably damaging 1.00
R4196:Pkd1l1 UTSW 11 8,909,929 (GRCm38) missense probably damaging 1.00
R4246:Pkd1l1 UTSW 11 8,865,543 (GRCm38) missense possibly damaging 0.51
R4247:Pkd1l1 UTSW 11 8,865,543 (GRCm38) missense possibly damaging 0.51
R4249:Pkd1l1 UTSW 11 8,865,543 (GRCm38) missense possibly damaging 0.51
R4250:Pkd1l1 UTSW 11 8,865,543 (GRCm38) missense possibly damaging 0.51
R4593:Pkd1l1 UTSW 11 8,901,253 (GRCm38) missense probably damaging 0.97
R4609:Pkd1l1 UTSW 11 8,958,964 (GRCm38) missense unknown
R4797:Pkd1l1 UTSW 11 8,961,340 (GRCm38) missense unknown
R4910:Pkd1l1 UTSW 11 8,929,360 (GRCm38) missense possibly damaging 0.50
R4940:Pkd1l1 UTSW 11 8,844,585 (GRCm38) missense probably benign
R5084:Pkd1l1 UTSW 11 8,942,004 (GRCm38) missense probably benign 0.05
R5147:Pkd1l1 UTSW 11 8,849,003 (GRCm38) missense possibly damaging 0.71
R5360:Pkd1l1 UTSW 11 8,879,204 (GRCm38) missense probably benign
R5483:Pkd1l1 UTSW 11 8,901,141 (GRCm38) critical splice donor site probably null
R5604:Pkd1l1 UTSW 11 8,833,877 (GRCm38) missense probably damaging 0.98
R5642:Pkd1l1 UTSW 11 8,879,202 (GRCm38) missense probably damaging 1.00
R5652:Pkd1l1 UTSW 11 8,909,889 (GRCm38) missense probably benign 0.03
R5751:Pkd1l1 UTSW 11 8,867,204 (GRCm38) missense possibly damaging 0.45
R5761:Pkd1l1 UTSW 11 8,916,301 (GRCm38) missense probably damaging 1.00
R5800:Pkd1l1 UTSW 11 8,861,302 (GRCm38) missense probably benign
R5874:Pkd1l1 UTSW 11 8,908,688 (GRCm38) missense probably damaging 1.00
R5897:Pkd1l1 UTSW 11 8,879,176 (GRCm38) missense probably benign 0.03
R5913:Pkd1l1 UTSW 11 8,863,849 (GRCm38) missense probably benign 0.00
R5930:Pkd1l1 UTSW 11 8,958,969 (GRCm38) missense unknown
R6000:Pkd1l1 UTSW 11 8,950,427 (GRCm38) missense probably benign 0.00
R6005:Pkd1l1 UTSW 11 8,857,113 (GRCm38) missense probably damaging 1.00
R6013:Pkd1l1 UTSW 11 8,869,452 (GRCm38) splice site probably null
R6027:Pkd1l1 UTSW 11 8,916,272 (GRCm38) nonsense probably null
R6028:Pkd1l1 UTSW 11 8,836,267 (GRCm38) missense probably benign 0.06
R6129:Pkd1l1 UTSW 11 8,868,543 (GRCm38) missense probably benign 0.00
R6182:Pkd1l1 UTSW 11 8,865,555 (GRCm38) missense probably benign 0.36
R6226:Pkd1l1 UTSW 11 8,901,287 (GRCm38) missense probably benign 0.00
R6257:Pkd1l1 UTSW 11 8,942,195 (GRCm38) missense probably benign 0.22
R6340:Pkd1l1 UTSW 11 8,844,649 (GRCm38) missense probably benign 0.09
R6478:Pkd1l1 UTSW 11 8,863,911 (GRCm38) missense probably benign 0.00
R6558:Pkd1l1 UTSW 11 8,889,052 (GRCm38) missense probably benign 0.00
R6750:Pkd1l1 UTSW 11 8,973,217 (GRCm38) missense unknown
R6987:Pkd1l1 UTSW 11 8,902,575 (GRCm38) missense probably benign 0.01
R6996:Pkd1l1 UTSW 11 8,849,046 (GRCm38) missense probably damaging 1.00
R7139:Pkd1l1 UTSW 11 8,890,737 (GRCm38) missense
R7224:Pkd1l1 UTSW 11 8,945,241 (GRCm38) missense
R7244:Pkd1l1 UTSW 11 8,871,771 (GRCm38) missense
R7265:Pkd1l1 UTSW 11 8,929,402 (GRCm38) missense
R7358:Pkd1l1 UTSW 11 8,945,202 (GRCm38) missense
R7387:Pkd1l1 UTSW 11 8,901,203 (GRCm38) missense
R7414:Pkd1l1 UTSW 11 8,916,267 (GRCm38) missense
R7459:Pkd1l1 UTSW 11 8,902,428 (GRCm38) missense
R7478:Pkd1l1 UTSW 11 8,929,441 (GRCm38) missense
R7485:Pkd1l1 UTSW 11 8,965,148 (GRCm38) missense
R7490:Pkd1l1 UTSW 11 8,916,265 (GRCm38) missense
R7644:Pkd1l1 UTSW 11 8,875,758 (GRCm38) missense
R7647:Pkd1l1 UTSW 11 8,947,296 (GRCm38) missense
R7687:Pkd1l1 UTSW 11 8,854,390 (GRCm38) missense
R7699:Pkd1l1 UTSW 11 8,965,142 (GRCm38) missense
R7922:Pkd1l1 UTSW 11 8,909,857 (GRCm38) missense
R7922:Pkd1l1 UTSW 11 8,849,013 (GRCm38) missense
R7980:Pkd1l1 UTSW 11 8,854,375 (GRCm38) missense probably damaging 1.00
R7993:Pkd1l1 UTSW 11 8,945,262 (GRCm38) missense
R8052:Pkd1l1 UTSW 11 8,947,315 (GRCm38) missense
R8125:Pkd1l1 UTSW 11 8,947,241 (GRCm38) missense probably damaging 1.00
R8420:Pkd1l1 UTSW 11 8,870,277 (GRCm38) nonsense probably null
R8675:Pkd1l1 UTSW 11 8,848,916 (GRCm38) critical splice donor site probably null
R8683:Pkd1l1 UTSW 11 8,871,805 (GRCm38) missense
R8709:Pkd1l1 UTSW 11 8,855,567 (GRCm38) missense
R8711:Pkd1l1 UTSW 11 8,865,550 (GRCm38) missense
R8725:Pkd1l1 UTSW 11 8,961,482 (GRCm38) missense
R8733:Pkd1l1 UTSW 11 8,933,657 (GRCm38) missense
R8822:Pkd1l1 UTSW 11 8,856,312 (GRCm38) missense
R8871:Pkd1l1 UTSW 11 8,950,503 (GRCm38) missense
R9009:Pkd1l1 UTSW 11 8,931,552 (GRCm38) missense
R9099:Pkd1l1 UTSW 11 8,972,986 (GRCm38) missense
R9119:Pkd1l1 UTSW 11 8,879,107 (GRCm38) missense
R9150:Pkd1l1 UTSW 11 8,836,256 (GRCm38) missense
R9314:Pkd1l1 UTSW 11 8,879,153 (GRCm38) missense
R9341:Pkd1l1 UTSW 11 8,961,305 (GRCm38) missense
R9341:Pkd1l1 UTSW 11 8,836,399 (GRCm38) missense
R9343:Pkd1l1 UTSW 11 8,961,305 (GRCm38) missense
R9343:Pkd1l1 UTSW 11 8,836,399 (GRCm38) missense
R9392:Pkd1l1 UTSW 11 8,844,567 (GRCm38) missense
R9424:Pkd1l1 UTSW 11 8,870,091 (GRCm38) missense
R9496:Pkd1l1 UTSW 11 8,833,773 (GRCm38) critical splice donor site probably null
R9504:Pkd1l1 UTSW 11 8,865,631 (GRCm38) missense
R9563:Pkd1l1 UTSW 11 8,865,502 (GRCm38) missense
R9570:Pkd1l1 UTSW 11 8,890,697 (GRCm38) missense
R9585:Pkd1l1 UTSW 11 8,854,390 (GRCm38) missense
R9618:Pkd1l1 UTSW 11 8,961,420 (GRCm38) missense
R9709:Pkd1l1 UTSW 11 8,849,016 (GRCm38) missense probably damaging 0.98
R9741:Pkd1l1 UTSW 11 8,947,224 (GRCm38) missense
R9801:Pkd1l1 UTSW 11 8,958,964 (GRCm38) nonsense probably null
X0024:Pkd1l1 UTSW 11 8,950,413 (GRCm38) missense probably benign 0.01
X0063:Pkd1l1 UTSW 11 8,929,430 (GRCm38) missense probably damaging 0.96
X0065:Pkd1l1 UTSW 11 8,909,921 (GRCm38) missense probably benign 0.10
Z1176:Pkd1l1 UTSW 11 8,826,801 (GRCm38) missense
Z1177:Pkd1l1 UTSW 11 8,945,208 (GRCm38) missense
Predicted Primers PCR Primer
(F):5'- GCCTCAGCAATAGACCACTG -3'
(R):5'- AATTTAAAGAGAGAAACCCTGTGCC -3'

Sequencing Primer
(F):5'- CCACTGAGGGGGTAGAACTACATC -3'
(R):5'- CCAGCTACACCATTTAAGTGTATGC -3'
Posted On 2019-11-12