Incidental Mutation 'R7676:Pip4k2b'
ID 592465
Institutional Source Beutler Lab
Gene Symbol Pip4k2b
Ensembl Gene ENSMUSG00000018547
Gene Name phosphatidylinositol-5-phosphate 4-kinase, type II, beta
Synonyms Pip5k2b, PI5P4Kbeta, c11
MMRRC Submission
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.368) question?
Stock # R7676 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 97715157-97744704 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 97720362 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 309 (N309K)
Ref Sequence ENSEMBL: ENSMUSP00000018691 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018691]
AlphaFold Q80XI4
Predicted Effect probably benign
Transcript: ENSMUST00000018691
AA Change: N309K

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000018691
Gene: ENSMUSG00000018547
AA Change: N309K

DomainStartEndE-ValueType
PIPKc 67 416 4.49e-156 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the phosphorylation of phosphatidylinositol-5-phosphate on the fourth hydroxyl of the myo-inositol ring to form phosphatidylinositol-5,4-bisphosphate. This gene is a member of the phosphatidylinositol-5-phosphate 4-kinase family. The encoded protein sequence does not show similarity to other kinases, but the protein does exhibit kinase activity. Additionally, the encoded protein interacts with p55 TNF receptor. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene are smaller than normal with less body fat and an increased sensitivity to insulin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca A G 11: 84,294,987 D116G possibly damaging Het
Adam6a G A 12: 113,544,576 G190S probably benign Het
Adnp G A 2: 168,183,447 R643* probably null Het
Akap6 A G 12: 52,886,850 D375G possibly damaging Het
Aldh1l2 G T 10: 83,508,111 A480E probably benign Het
Ccdc175 T A 12: 72,102,047 Q779L possibly damaging Het
D430042O09Rik A G 7: 125,850,377 D897G probably benign Het
Dnah7b T G 1: 46,234,164 L2484* probably null Het
Dnajc21 T C 15: 10,462,344 Y65C possibly damaging Het
Dnhd1 C A 7: 105,684,087 N255K probably benign Het
Efhc1 G T 1: 20,967,369 G257W probably damaging Het
Fars2 C A 13: 36,205,043 L172I probably benign Het
Fat4 T C 3: 38,891,697 Y1580H probably damaging Het
Fli1 T A 9: 32,428,030 N253Y probably benign Het
Foxd3 G T 4: 99,656,914 C97F probably damaging Het
Gem C A 4: 11,711,170 D120E possibly damaging Het
Ighv10-3 A G 12: 114,523,679 C41R probably damaging Het
Kcnab3 A G 11: 69,326,727 S16G probably benign Het
Keg1 T G 19: 12,716,045 V154G probably benign Het
Lrrc45 G A 11: 120,720,322 R602H probably damaging Het
Ltbp1 A G 17: 75,291,297 D591G possibly damaging Het
Mmp10 T A 9: 7,503,549 V140D probably damaging Het
Nat8f2 A T 6: 85,868,212 M56K probably benign Het
Nckipsd T C 9: 108,814,954 F525L probably damaging Het
Olfr1328 A G 4: 118,934,150 S233P probably damaging Het
Olfr1406 T A 1: 173,183,553 K294* probably null Het
Olfr804 G T 10: 129,705,286 S136I possibly damaging Het
P2ry12 T A 3: 59,217,757 M166L possibly damaging Het
Palm3 T C 8: 84,029,445 S529P possibly damaging Het
Pdilt A T 7: 119,494,997 Y344N probably damaging Het
Pkd1l1 C T 11: 8,962,708 V166I Het
Plxdc2 C T 2: 16,712,083 S377L probably benign Het
Rc3h2 A T 2: 37,405,332 V224E possibly damaging Het
Stk32c T A 7: 139,105,304 D428V possibly damaging Het
Ttn T C 2: 76,814,607 D12968G probably damaging Het
Tulp2 G T 7: 45,521,027 V457F possibly damaging Het
Vcan A T 13: 89,691,789 S1879T probably damaging Het
Vmn1r51 T C 6: 90,129,455 Y118H probably benign Het
Zfat A C 15: 68,224,844 V40G possibly damaging Het
Other mutations in Pip4k2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00954:Pip4k2b APN 11 97744505 missense probably damaging 1.00
IGL01567:Pip4k2b APN 11 97729561 missense probably damaging 0.99
IGL01568:Pip4k2b APN 11 97729552 critical splice donor site probably null
IGL03004:Pip4k2b APN 11 97724474 missense probably damaging 1.00
bigun UTSW 11 97722936 splice site probably benign
yuge UTSW 11 97722434 missense probably benign 0.04
R0119:Pip4k2b UTSW 11 97722936 splice site probably benign
R0657:Pip4k2b UTSW 11 97722936 splice site probably benign
R1223:Pip4k2b UTSW 11 97718894 missense probably damaging 1.00
R1252:Pip4k2b UTSW 11 97744594 missense probably benign 0.45
R2914:Pip4k2b UTSW 11 97722434 missense probably benign 0.04
R3702:Pip4k2b UTSW 11 97729548 splice site probably benign
R4173:Pip4k2b UTSW 11 97722375 missense probably benign 0.06
R4998:Pip4k2b UTSW 11 97722435 missense possibly damaging 0.49
R5084:Pip4k2b UTSW 11 97719743 missense probably damaging 1.00
R5128:Pip4k2b UTSW 11 97718876 missense probably benign 0.01
R6590:Pip4k2b UTSW 11 97729567 missense probably damaging 1.00
R6690:Pip4k2b UTSW 11 97729567 missense probably damaging 1.00
R7104:Pip4k2b UTSW 11 97732716 missense possibly damaging 0.83
R9161:Pip4k2b UTSW 11 97724419 missense possibly damaging 0.87
R9277:Pip4k2b UTSW 11 97722446 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACAGTGAGCAGAGCACTC -3'
(R):5'- TGAATGGGTTGCTTCCTCCC -3'

Sequencing Primer
(F):5'- CAGAGCACTCGGGGCTG -3'
(R):5'- CTCCCTTTCCAGATGTGGGG -3'
Posted On 2019-11-12