Mutagenetix > Incidental Mutation

Incidental Mutation 'R7676:Akap6'

592467

Institutional Source

Beutler Lab

Gene Symbol

Akap6

Ensembl Gene

ENSMUSG00000061603

Gene Name

A kinase (PRKA) anchor protein 6

Synonyms

MMRRC Submission

045647-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.868) question?

Stock #

R7676 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

52699383-53155599 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 52886850 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 375 (D375G)

Ref Sequence

ENSEMBL: ENSMUSP00000093406 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095737] [ENSMUST00000219786]

AlphaFold

E9Q9K8

Predicted Effect

possibly damaging
Transcript: ENSMUST00000095737
AA Change: D375G

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000093406
Gene: ENSMUSG00000061603
AA Change: D375G

Domain	Start	End	E-Value	Type
low complexity region	34	51	N/A	INTRINSIC
Blast:SPEC	66	168	2e-50	BLAST
low complexity region	441	455	N/A	INTRINSIC
low complexity region	544	555	N/A	INTRINSIC
low complexity region	569	587	N/A	INTRINSIC
low complexity region	640	651	N/A	INTRINSIC
low complexity region	694	708	N/A	INTRINSIC
SPEC	779	880	1.06e-1	SMART
SPEC	959	1057	1.45e0	SMART
SPEC	1078	1185	2.56e-2	SMART
low complexity region	1316	1332	N/A	INTRINSIC
low complexity region	1555	1568	N/A	INTRINSIC
low complexity region	1610	1622	N/A	INTRINSIC
low complexity region	1683	1698	N/A	INTRINSIC
low complexity region	1737	1781	N/A	INTRINSIC
low complexity region	1899	1910	N/A	INTRINSIC
low complexity region	2019	2031	N/A	INTRINSIC
low complexity region	2104	2115	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000219786
AA Change: D375G

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The A-kinase anchor proteins (AKAPs) are a group of structurally diverse proteins, which have the common function of binding to the regulatory subunit of protein kinase A (PKA) and confining the holoenzyme to discrete locations within the cell. This gene encodes a member of the AKAP family. The encoded protein is highly expressed in various brain regions and cardiac and skeletal muscle. It is specifically localized to the sarcoplasmic reticulum and nuclear membrane, and is involved in anchoring PKA to the nuclear membrane or sarcoplasmic reticulum. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted disruption of this gene results in partial embryonic lethality; surviving homozygotes display a decreased body weight, craniofacial defects and reduced viability. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acaca	A	G	11: 84,294,987	D116G	possibly damaging	Het
Adam6a	G	A	12: 113,544,576	G190S	probably benign	Het
Adnp	G	A	2: 168,183,447	R643*	probably null	Het
Aldh1l2	G	T	10: 83,508,111	A480E	probably benign	Het
Ccdc175	T	A	12: 72,102,047	Q779L	possibly damaging	Het
D430042O09Rik	A	G	7: 125,850,377	D897G	probably benign	Het
Dnah7b	T	G	1: 46,234,164	L2484*	probably null	Het
Dnajc21	T	C	15: 10,462,344	Y65C	possibly damaging	Het
Dnhd1	C	A	7: 105,684,087	N255K	probably benign	Het
Efhc1	G	T	1: 20,967,369	G257W	probably damaging	Het
Fars2	C	A	13: 36,205,043	L172I	probably benign	Het
Fat4	T	C	3: 38,891,697	Y1580H	probably damaging	Het
Fli1	T	A	9: 32,428,030	N253Y	probably benign	Het
Foxd3	G	T	4: 99,656,914	C97F	probably damaging	Het
Gem	C	A	4: 11,711,170	D120E	possibly damaging	Het
Ighv10-3	A	G	12: 114,523,679	C41R	probably damaging	Het
Kcnab3	A	G	11: 69,326,727	S16G	probably benign	Het
Keg1	T	G	19: 12,716,045	V154G	probably benign	Het
Lrrc45	G	A	11: 120,720,322	R602H	probably damaging	Het
Ltbp1	A	G	17: 75,291,297	D591G	possibly damaging	Het
Mmp10	T	A	9: 7,503,549	V140D	probably damaging	Het
Nat8f2	A	T	6: 85,868,212	M56K	probably benign	Het
Nckipsd	T	C	9: 108,814,954	F525L	probably damaging	Het
Olfr1328	A	G	4: 118,934,150	S233P	probably damaging	Het
Olfr1406	T	A	1: 173,183,553	K294*	probably null	Het
Olfr804	G	T	10: 129,705,286	S136I	possibly damaging	Het
P2ry12	T	A	3: 59,217,757	M166L	possibly damaging	Het
Palm3	T	C	8: 84,029,445	S529P	possibly damaging	Het
Pdilt	A	T	7: 119,494,997	Y344N	probably damaging	Het
Pip4k2b	A	T	11: 97,720,362	N309K	probably benign	Het
Pkd1l1	C	T	11: 8,962,708	V166I		Het
Plxdc2	C	T	2: 16,712,083	S377L	probably benign	Het
Rc3h2	A	T	2: 37,405,332	V224E	possibly damaging	Het
Stk32c	T	A	7: 139,105,304	D428V	possibly damaging	Het
Ttn	T	C	2: 76,814,607	D12968G	probably damaging	Het
Tulp2	G	T	7: 45,521,027	V457F	possibly damaging	Het
Vcan	A	T	13: 89,691,789	S1879T	probably damaging	Het
Vmn1r51	T	C	6: 90,129,455	Y118H	probably benign	Het
Zfat	A	C	15: 68,224,844	V40G	possibly damaging	Het

Other mutations in Akap6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00094:Akap6	APN	12	53140980	missense	possibly damaging	0.79
IGL00505:Akap6	APN	12	52887102	missense	possibly damaging	0.92
IGL01134:Akap6	APN	12	52937217	missense	probably damaging	0.96
IGL01458:Akap6	APN	12	52886818	nonsense	probably null
IGL01589:Akap6	APN	12	53139664	missense	probably damaging	1.00
IGL01592:Akap6	APN	12	53142142	missense	probably damaging	1.00
IGL01738:Akap6	APN	12	52886817	missense	probably damaging	0.99
IGL01867:Akap6	APN	12	52888008	missense	probably damaging	1.00
IGL02025:Akap6	APN	12	53140335	missense	probably benign
IGL02041:Akap6	APN	12	53140653	missense	probably damaging	1.00
IGL02058:Akap6	APN	12	53140555	missense	probably damaging	1.00
IGL02194:Akap6	APN	12	52886823	missense	probably benign	0.00
IGL02226:Akap6	APN	12	53010467	splice site	probably benign
IGL02323:Akap6	APN	12	53140429	missense	probably benign	0.00
IGL02449:Akap6	APN	12	53140188	missense	probably damaging	1.00
IGL02475:Akap6	APN	12	53139494	missense	probably benign	0.03
IGL02546:Akap6	APN	12	52880738	missense	probably damaging	1.00
IGL02547:Akap6	APN	12	53140696	missense	probably damaging	1.00
IGL02588:Akap6	APN	12	52886499	nonsense	probably null
IGL02608:Akap6	APN	12	53010606	missense	probably benign	0.39
IGL02884:Akap6	APN	12	52886622	missense	probably benign	0.00
IGL02945:Akap6	APN	12	52880837	missense	probably damaging	1.00
IGL03029:Akap6	APN	12	52886412	missense	probably damaging	1.00
IGL03129:Akap6	APN	12	53140306	missense	probably damaging	1.00
R0133:Akap6	UTSW	12	53139471	nonsense	probably null
R0166:Akap6	UTSW	12	53140924	missense	probably benign	0.04
R0189:Akap6	UTSW	12	53141254	missense	probably benign	0.41
R0532:Akap6	UTSW	12	52887983	missense	probably benign	0.00
R0632:Akap6	UTSW	12	52937148	missense	probably damaging	1.00
R0666:Akap6	UTSW	12	52911808	missense	probably damaging	1.00
R0723:Akap6	UTSW	12	53141902	missense	probably damaging	1.00
R0763:Akap6	UTSW	12	53142214	missense	possibly damaging	0.93
R0785:Akap6	UTSW	12	52886622	missense	probably benign	0.00
R0879:Akap6	UTSW	12	52880799	missense	probably damaging	1.00
R0880:Akap6	UTSW	12	53139508	missense	possibly damaging	0.93
R1033:Akap6	UTSW	12	53069222	missense	probably damaging	0.97
R1055:Akap6	UTSW	12	52880672	nonsense	probably null
R1199:Akap6	UTSW	12	52796190	missense	probably damaging	1.00
R1295:Akap6	UTSW	12	52887029	missense	probably damaging	1.00
R1389:Akap6	UTSW	12	53139520	missense	probably benign	0.15
R1471:Akap6	UTSW	12	53141496	missense	probably benign	0.05
R1483:Akap6	UTSW	12	52796087	missense	probably damaging	1.00
R1512:Akap6	UTSW	12	52937154	missense	probably damaging	1.00
R1648:Akap6	UTSW	12	53142006	nonsense	probably null
R1791:Akap6	UTSW	12	53069125	missense	probably damaging	1.00
R1888:Akap6	UTSW	12	53142175	missense	possibly damaging	0.88
R1888:Akap6	UTSW	12	53142175	missense	possibly damaging	0.88
R1891:Akap6	UTSW	12	53142175	missense	possibly damaging	0.88
R1899:Akap6	UTSW	12	53141852	missense	possibly damaging	0.95
R1917:Akap6	UTSW	12	53104612	missense	probably benign	0.13
R1970:Akap6	UTSW	12	52938475	missense	probably damaging	0.96
R1987:Akap6	UTSW	12	53140795	missense	possibly damaging	0.78
R1988:Akap6	UTSW	12	53140795	missense	possibly damaging	0.78
R2153:Akap6	UTSW	12	53141404	missense	probably benign	0.03
R2567:Akap6	UTSW	12	52938373	missense	probably damaging	1.00
R2568:Akap6	UTSW	12	52887278	missense	possibly damaging	0.77
R3025:Akap6	UTSW	12	53140143	missense	probably benign
R3051:Akap6	UTSW	12	52887033	missense	probably damaging	1.00
R3195:Akap6	UTSW	12	53072457	nonsense	probably null
R3196:Akap6	UTSW	12	53072457	nonsense	probably null
R3426:Akap6	UTSW	12	52888034	missense	probably damaging	1.00
R3783:Akap6	UTSW	12	52880769	missense	probably damaging	1.00
R3934:Akap6	UTSW	12	53140444	missense	possibly damaging	0.92
R3936:Akap6	UTSW	12	53140444	missense	possibly damaging	0.92
R3967:Akap6	UTSW	12	53141453	missense	probably damaging	1.00
R3970:Akap6	UTSW	12	53141453	missense	probably damaging	1.00
R4042:Akap6	UTSW	12	53139379	critical splice acceptor site	probably null
R4095:Akap6	UTSW	12	53139462	missense	probably damaging	1.00
R4152:Akap6	UTSW	12	53140407	missense	probably benign	0.45
R4231:Akap6	UTSW	12	53141038	missense	probably damaging	1.00
R4232:Akap6	UTSW	12	53139671	missense	probably damaging	1.00
R4233:Akap6	UTSW	12	53139671	missense	probably damaging	1.00
R4234:Akap6	UTSW	12	53139671	missense	probably damaging	1.00
R4235:Akap6	UTSW	12	53139671	missense	probably damaging	1.00
R4236:Akap6	UTSW	12	53139671	missense	probably damaging	1.00
R4475:Akap6	UTSW	12	53141643	missense	probably benign	0.00
R4513:Akap6	UTSW	12	52796004	missense	probably benign	0.03
R4686:Akap6	UTSW	12	52887623	frame shift	probably null
R4724:Akap6	UTSW	12	52795885	missense	possibly damaging	0.80
R4782:Akap6	UTSW	12	52887623	frame shift	probably null
R4852:Akap6	UTSW	12	53104675	missense	probably damaging	1.00
R5024:Akap6	UTSW	12	53142562	missense	probably benign	0.01
R5116:Akap6	UTSW	12	53141515	missense	probably benign	0.01
R5164:Akap6	UTSW	12	53142466	missense	probably benign
R5225:Akap6	UTSW	12	52886546	missense	probably damaging	1.00
R5269:Akap6	UTSW	12	53139843	missense	probably damaging	0.99
R5352:Akap6	UTSW	12	52796097	missense	probably damaging	1.00
R5496:Akap6	UTSW	12	53140653	missense	possibly damaging	0.87
R5551:Akap6	UTSW	12	52795964	missense	probably damaging	1.00
R5997:Akap6	UTSW	12	52937233	critical splice donor site	probably null
R6137:Akap6	UTSW	12	53140354	missense	probably damaging	1.00
R6151:Akap6	UTSW	12	53025792	missense	probably damaging	1.00
R6169:Akap6	UTSW	12	53142358	missense	probably benign
R6307:Akap6	UTSW	12	53141568	missense	possibly damaging	0.85
R6351:Akap6	UTSW	12	53142025	missense	probably damaging	0.98
R6479:Akap6	UTSW	12	53141169	missense	probably damaging	1.00
R6502:Akap6	UTSW	12	53140215	missense	probably damaging	1.00
R6760:Akap6	UTSW	12	53139778	missense	probably damaging	1.00
R6778:Akap6	UTSW	12	53025816	missense	probably damaging	1.00
R6837:Akap6	UTSW	12	53141262	missense	probably damaging	1.00
R6896:Akap6	UTSW	12	52887494	missense	probably benign	0.06
R6917:Akap6	UTSW	12	53069168	missense	probably null	0.97
R6983:Akap6	UTSW	12	52887653	missense	probably damaging	1.00
R7142:Akap6	UTSW	12	52887364	missense	probably benign	0.02
R7143:Akap6	UTSW	12	52887364	missense	probably benign	0.02
R7216:Akap6	UTSW	12	53140457	missense	probably benign	0.02
R7297:Akap6	UTSW	12	52887364	missense	probably benign	0.02
R7356:Akap6	UTSW	12	52911864	missense	probably damaging	1.00
R7378:Akap6	UTSW	12	53142574	missense	probably benign	0.00
R7382:Akap6	UTSW	12	53142171	missense	probably benign	0.00
R7498:Akap6	UTSW	12	53142705	nonsense	probably null
R7542:Akap6	UTSW	12	53069234	missense	probably damaging	1.00
R7589:Akap6	UTSW	12	53142063	nonsense	probably null
R7814:Akap6	UTSW	12	53140961	missense	probably benign	0.28
R7971:Akap6	UTSW	12	53139795	missense	probably damaging	1.00
R8039:Akap6	UTSW	12	53141676	missense	probably benign	0.00
R8425:Akap6	UTSW	12	52886621	missense	probably benign	0.00
R8747:Akap6	UTSW	12	53142216	missense	probably benign	0.01
R8885:Akap6	UTSW	12	53141536	missense	probably benign
R8956:Akap6	UTSW	12	53140344	missense	probably benign	0.00
R8989:Akap6	UTSW	12	52880871	missense	probably damaging	1.00
R9014:Akap6	UTSW	12	53139620	missense	possibly damaging	0.60
R9031:Akap6	UTSW	12	53142048	missense	probably benign	0.36
R9216:Akap6	UTSW	12	52880885	missense	probably benign	0.05
R9220:Akap6	UTSW	12	53140449	missense	possibly damaging	0.49
R9243:Akap6	UTSW	12	53141252	missense	probably benign	0.08
R9286:Akap6	UTSW	12	53072471	missense	possibly damaging	0.90
R9347:Akap6	UTSW	12	53069111	missense	probably damaging	1.00
R9475:Akap6	UTSW	12	53010552	missense	probably damaging	1.00
R9509:Akap6	UTSW	12	53142238	missense	probably damaging	0.99
R9523:Akap6	UTSW	12	52795889	missense	probably benign	0.02
R9600:Akap6	UTSW	12	52886558	missense	probably benign	0.04
R9612:Akap6	UTSW	12	52911907	missense	probably damaging	1.00
R9627:Akap6	UTSW	12	53104630	missense
R9666:Akap6	UTSW	12	53141535	missense	probably benign
R9784:Akap6	UTSW	12	53141070	missense	probably damaging	1.00
X0062:Akap6	UTSW	12	53142361	missense	probably benign	0.43
Z1176:Akap6	UTSW	12	53140444	missense	possibly damaging	0.92

Predicted Primers

PCR Primer
(F):5'- ACATGAGGAAGATGGCGCTC -3'
(R):5'- CAACACTAGGCAGAGCTTCG -3'

Sequencing Primer
(F):5'- AAGATGGCGCTCTTGAACCTG -3'
(R):5'- ACACTAGGCAGAGCTTCGATCTG -3'

Posted On

2019-11-12