Incidental Mutation 'R7676:Ccdc175'
ID592468
Institutional Source Beutler Lab
Gene Symbol Ccdc175
Ensembl Gene ENSMUSG00000021086
Gene Namecoiled-coil domain containing 175
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R7676 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location72101300-72185029 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 72102047 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 779 (Q779L)
Ref Sequence ENSEMBL: ENSMUSP00000021494 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021494] [ENSMUST00000057257] [ENSMUST00000117449]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021494
AA Change: Q779L

PolyPhen 2 Score 0.574 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000021494
Gene: ENSMUSG00000021086
AA Change: Q779L

DomainStartEndE-ValueType
coiled coil region 129 164 N/A INTRINSIC
coiled coil region 205 235 N/A INTRINSIC
coiled coil region 295 383 N/A INTRINSIC
low complexity region 470 490 N/A INTRINSIC
coiled coil region 517 537 N/A INTRINSIC
low complexity region 803 819 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000057257
SMART Domains Protein: ENSMUSP00000061370
Gene: ENSMUSG00000005078

DomainStartEndE-ValueType
Pfam:DUF766 9 300 3.6e-118 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117449
SMART Domains Protein: ENSMUSP00000113744
Gene: ENSMUSG00000005078

DomainStartEndE-ValueType
Pfam:DUF766 3 295 2.3e-145 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca A G 11: 84,294,987 D116G possibly damaging Het
Adam6a G A 12: 113,544,576 G190S probably benign Het
Adnp G A 2: 168,183,447 R643* probably null Het
Akap6 A G 12: 52,886,850 D375G possibly damaging Het
Aldh1l2 G T 10: 83,508,111 A480E probably benign Het
D430042O09Rik A G 7: 125,850,377 D897G probably benign Het
Dnah7b T G 1: 46,234,164 L2484* probably null Het
Dnajc21 T C 15: 10,462,344 Y65C possibly damaging Het
Dnhd1 C A 7: 105,684,087 N255K probably benign Het
Efhc1 G T 1: 20,967,369 G257W probably damaging Het
Fars2 C A 13: 36,205,043 L172I probably benign Het
Fat4 T C 3: 38,891,697 Y1580H probably damaging Het
Fli1 T A 9: 32,428,030 N253Y probably benign Het
Foxd3 G T 4: 99,656,914 C97F probably damaging Het
Gem C A 4: 11,711,170 D120E possibly damaging Het
Ighv10-3 A G 12: 114,523,679 C41R probably damaging Het
Kcnab3 A G 11: 69,326,727 S16G probably benign Het
Keg1 T G 19: 12,716,045 V154G probably benign Het
Lrrc45 G A 11: 120,720,322 R602H probably damaging Het
Ltbp1 A G 17: 75,291,297 D591G possibly damaging Het
Mmp10 T A 9: 7,503,549 V140D probably damaging Het
Nat8f2 A T 6: 85,868,212 M56K probably benign Het
Nckipsd T C 9: 108,814,954 F525L probably damaging Het
Olfr1328 A G 4: 118,934,150 S233P probably damaging Het
Olfr1406 T A 1: 173,183,553 K294* probably null Het
Olfr804 G T 10: 129,705,286 S136I possibly damaging Het
P2ry12 T A 3: 59,217,757 M166L possibly damaging Het
Palm3 T C 8: 84,029,445 S529P possibly damaging Het
Pdilt A T 7: 119,494,997 Y344N probably damaging Het
Pip4k2b A T 11: 97,720,362 N309K probably benign Het
Pkd1l1 C T 11: 8,962,708 V166I Het
Plxdc2 C T 2: 16,712,083 S377L probably benign Het
Rc3h2 A T 2: 37,405,332 V224E possibly damaging Het
Stk32c T A 7: 139,105,304 D428V possibly damaging Het
Ttn T C 2: 76,814,607 D12968G probably damaging Het
Tulp2 G T 7: 45,521,027 V457F possibly damaging Het
Vcan A T 13: 89,691,789 S1879T probably damaging Het
Vmn1r51 T C 6: 90,129,455 Y118H probably benign Het
Zfat A C 15: 68,224,844 V40G possibly damaging Het
Other mutations in Ccdc175
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01524:Ccdc175 APN 12 72131142 splice site probably benign
IGL01805:Ccdc175 APN 12 72129229 splice site probably benign
IGL01807:Ccdc175 APN 12 72159842 missense probably benign 0.02
IGL01985:Ccdc175 APN 12 72128278 nonsense probably null
IGL02719:Ccdc175 APN 12 72175125 missense probably damaging 0.97
IGL02944:Ccdc175 APN 12 72117893 missense probably benign 0.02
IGL03113:Ccdc175 APN 12 72144783 missense probably benign 0.00
IGL03143:Ccdc175 APN 12 72136058 missense probably benign 0.03
IGL03356:Ccdc175 APN 12 72139893 splice site probably null
R0009:Ccdc175 UTSW 12 72135965 missense possibly damaging 0.87
R0233:Ccdc175 UTSW 12 72105876 missense probably benign 0.00
R0233:Ccdc175 UTSW 12 72105876 missense probably benign 0.00
R0609:Ccdc175 UTSW 12 72157507 missense probably benign 0.07
R0706:Ccdc175 UTSW 12 72139948 missense probably benign 0.04
R0948:Ccdc175 UTSW 12 72131123 missense probably damaging 1.00
R1054:Ccdc175 UTSW 12 72178544 missense possibly damaging 0.85
R1166:Ccdc175 UTSW 12 72105932 missense probably damaging 1.00
R1481:Ccdc175 UTSW 12 72101948 unclassified probably benign
R1860:Ccdc175 UTSW 12 72105926 missense probably benign
R2077:Ccdc175 UTSW 12 72140020 missense possibly damaging 0.54
R3806:Ccdc175 UTSW 12 72180824 missense possibly damaging 0.72
R3879:Ccdc175 UTSW 12 72136018 missense probably damaging 1.00
R3887:Ccdc175 UTSW 12 72136048 missense possibly damaging 0.65
R4557:Ccdc175 UTSW 12 72128306 missense probably benign 0.08
R4585:Ccdc175 UTSW 12 72175179 missense possibly damaging 0.65
R4686:Ccdc175 UTSW 12 72112278 missense probably damaging 1.00
R4766:Ccdc175 UTSW 12 72112205 missense probably benign 0.00
R4773:Ccdc175 UTSW 12 72136048 missense probably damaging 0.99
R4909:Ccdc175 UTSW 12 72159753 missense probably damaging 1.00
R4964:Ccdc175 UTSW 12 72180845 missense probably damaging 1.00
R5338:Ccdc175 UTSW 12 72184971 missense probably damaging 0.99
R5539:Ccdc175 UTSW 12 72144813 missense probably benign 0.00
R5897:Ccdc175 UTSW 12 72159804 missense probably benign 0.06
R6128:Ccdc175 UTSW 12 72129159 missense probably benign 0.07
R6520:Ccdc175 UTSW 12 72140030 missense probably damaging 0.98
R6523:Ccdc175 UTSW 12 72144791 missense probably benign 0.01
R6917:Ccdc175 UTSW 12 72184905 missense probably damaging 1.00
R7035:Ccdc175 UTSW 12 72155645 missense probably benign 0.01
R7097:Ccdc175 UTSW 12 72128409 splice site probably null
R7339:Ccdc175 UTSW 12 72136041 missense probably damaging 1.00
R7450:Ccdc175 UTSW 12 72155673 missense possibly damaging 0.93
R7481:Ccdc175 UTSW 12 72155624 missense probably benign 0.00
R8045:Ccdc175 UTSW 12 72155902 intron probably benign
Z1088:Ccdc175 UTSW 12 72128379 missense probably benign 0.01
Z1176:Ccdc175 UTSW 12 72112308 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- AAGTTAGTCCCCGAGTCTGCTC -3'
(R):5'- TGCCTCTGCAGAATTGTAACC -3'

Sequencing Primer
(F):5'- CATGGCAACTCTGAAGACTTCTACTG -3'
(R):5'- CTCTGCAGAATTGTAACCTTTTTATC -3'
Posted On2019-11-12