Incidental Mutation 'R7676:Adam6a'
ID 592469
Institutional Source Beutler Lab
Gene Symbol Adam6a
Ensembl Gene ENSMUSG00000043945
Gene Name a disintegrin and metallopeptidase domain 6A
Synonyms Adam6
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock # R7676 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 113543908-113546465 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 113544576 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Serine at position 190 (G190S)
Ref Sequence ENSEMBL: ENSMUSP00000059315 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053086]
AlphaFold B2RSY5
Predicted Effect probably benign
Transcript: ENSMUST00000053086
AA Change: G190S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000059315
Gene: ENSMUSG00000043945
AA Change: G190S

DomainStartEndE-ValueType
Pfam:Pep_M12B_propep 30 167 6.9e-17 PFAM
Pfam:Reprolysin 222 407 4e-15 PFAM
DISIN 427 502 1.63e-33 SMART
ACR 503 640 7.46e-62 SMART
transmembrane domain 704 726 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca A G 11: 84,294,987 D116G possibly damaging Het
Adnp G A 2: 168,183,447 R643* probably null Het
Akap6 A G 12: 52,886,850 D375G possibly damaging Het
Aldh1l2 G T 10: 83,508,111 A480E probably benign Het
Ccdc175 T A 12: 72,102,047 Q779L possibly damaging Het
D430042O09Rik A G 7: 125,850,377 D897G probably benign Het
Dnah7b T G 1: 46,234,164 L2484* probably null Het
Dnajc21 T C 15: 10,462,344 Y65C possibly damaging Het
Dnhd1 C A 7: 105,684,087 N255K probably benign Het
Efhc1 G T 1: 20,967,369 G257W probably damaging Het
Fars2 C A 13: 36,205,043 L172I probably benign Het
Fat4 T C 3: 38,891,697 Y1580H probably damaging Het
Fli1 T A 9: 32,428,030 N253Y probably benign Het
Foxd3 G T 4: 99,656,914 C97F probably damaging Het
Gem C A 4: 11,711,170 D120E possibly damaging Het
Ighv10-3 A G 12: 114,523,679 C41R probably damaging Het
Kcnab3 A G 11: 69,326,727 S16G probably benign Het
Keg1 T G 19: 12,716,045 V154G probably benign Het
Lrrc45 G A 11: 120,720,322 R602H probably damaging Het
Ltbp1 A G 17: 75,291,297 D591G possibly damaging Het
Mmp10 T A 9: 7,503,549 V140D probably damaging Het
Nat8f2 A T 6: 85,868,212 M56K probably benign Het
Nckipsd T C 9: 108,814,954 F525L probably damaging Het
Olfr1328 A G 4: 118,934,150 S233P probably damaging Het
Olfr1406 T A 1: 173,183,553 K294* probably null Het
Olfr804 G T 10: 129,705,286 S136I possibly damaging Het
P2ry12 T A 3: 59,217,757 M166L possibly damaging Het
Palm3 T C 8: 84,029,445 S529P possibly damaging Het
Pdilt A T 7: 119,494,997 Y344N probably damaging Het
Pip4k2b A T 11: 97,720,362 N309K probably benign Het
Pkd1l1 C T 11: 8,962,708 V166I Het
Plxdc2 C T 2: 16,712,083 S377L probably benign Het
Rc3h2 A T 2: 37,405,332 V224E possibly damaging Het
Stk32c T A 7: 139,105,304 D428V possibly damaging Het
Ttn T C 2: 76,814,607 D12968G probably damaging Het
Tulp2 G T 7: 45,521,027 V457F possibly damaging Het
Vcan A T 13: 89,691,789 S1879T probably damaging Het
Vmn1r51 T C 6: 90,129,455 Y118H probably benign Het
Zfat A C 15: 68,224,844 V40G possibly damaging Het
Other mutations in Adam6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Adam6a APN 12 113545225 missense probably benign 0.00
IGL00896:Adam6a APN 12 113545410 missense possibly damaging 0.56
IGL01146:Adam6a APN 12 113544220 missense probably damaging 1.00
IGL01285:Adam6a APN 12 113546273 makesense probably null
IGL01839:Adam6a APN 12 113544622 missense probably benign 0.03
IGL01906:Adam6a APN 12 113544331 missense probably benign 0.19
IGL02306:Adam6a APN 12 113545723 missense possibly damaging 0.93
IGL03146:Adam6a APN 12 113545524 missense probably damaging 1.00
IGL03176:Adam6a APN 12 113546202 missense probably benign 0.00
IGL03365:Adam6a APN 12 113544145 missense possibly damaging 0.86
IGL03373:Adam6a APN 12 113545552 missense possibly damaging 0.55
PIT4802001:Adam6a UTSW 12 113545458 missense probably damaging 1.00
R0091:Adam6a UTSW 12 113544229 missense possibly damaging 0.46
R0149:Adam6a UTSW 12 113545749 missense probably damaging 1.00
R0348:Adam6a UTSW 12 113544717 missense probably damaging 0.99
R0376:Adam6a UTSW 12 113544690 missense probably damaging 1.00
R1471:Adam6a UTSW 12 113544393 missense probably damaging 1.00
R1474:Adam6a UTSW 12 113544449 missense possibly damaging 0.66
R1553:Adam6a UTSW 12 113545215 missense probably damaging 1.00
R1679:Adam6a UTSW 12 113544756 missense probably benign 0.00
R1808:Adam6a UTSW 12 113544714 missense probably benign 0.00
R1826:Adam6a UTSW 12 113546122 missense possibly damaging 0.46
R1856:Adam6a UTSW 12 113545303 missense probably damaging 1.00
R1916:Adam6a UTSW 12 113545936 missense probably benign
R2011:Adam6a UTSW 12 113545378 missense probably benign 0.09
R2049:Adam6a UTSW 12 113544429 missense probably benign 0.17
R2364:Adam6a UTSW 12 113544630 missense probably benign 0.05
R3820:Adam6a UTSW 12 113544178 missense probably benign 0.00
R4119:Adam6a UTSW 12 113544574 missense probably benign 0.06
R4540:Adam6a UTSW 12 113544499 missense probably damaging 1.00
R4627:Adam6a UTSW 12 113544949 missense probably benign
R4665:Adam6a UTSW 12 113544372 missense possibly damaging 0.64
R4859:Adam6a UTSW 12 113545989 missense probably damaging 1.00
R4997:Adam6a UTSW 12 113545371 missense probably damaging 1.00
R5270:Adam6a UTSW 12 113544127 missense possibly damaging 0.46
R5751:Adam6a UTSW 12 113544827 missense possibly damaging 0.79
R5775:Adam6a UTSW 12 113546266 missense possibly damaging 0.47
R5863:Adam6a UTSW 12 113544367 missense probably benign 0.01
R6154:Adam6a UTSW 12 113545672 missense probably benign 0.11
R6313:Adam6a UTSW 12 113545050 missense possibly damaging 0.56
R6316:Adam6a UTSW 12 113545576 missense probably benign 0.27
R6706:Adam6a UTSW 12 113545266 missense probably benign 0.00
R6845:Adam6a UTSW 12 113544097 missense possibly damaging 0.96
R7134:Adam6a UTSW 12 113545035 missense probably benign 0.04
R7179:Adam6a UTSW 12 113545671 missense probably benign 0.02
R7206:Adam6a UTSW 12 113546034 missense probably damaging 1.00
R7230:Adam6a UTSW 12 113545582 missense probably damaging 1.00
R7296:Adam6a UTSW 12 113545572 missense probably damaging 1.00
R7730:Adam6a UTSW 12 113544040 missense possibly damaging 0.86
R7743:Adam6a UTSW 12 113544532 missense probably benign
R7841:Adam6a UTSW 12 113545458 missense probably damaging 1.00
R8356:Adam6a UTSW 12 113546137 missense probably benign 0.08
R8531:Adam6a UTSW 12 113545297 missense probably damaging 1.00
R9568:Adam6a UTSW 12 113544400 missense possibly damaging 0.74
R9624:Adam6a UTSW 12 113545450 missense probably damaging 1.00
R9679:Adam6a UTSW 12 113545922 missense probably benign 0.00
R9680:Adam6a UTSW 12 113545864 nonsense probably null
X0027:Adam6a UTSW 12 113545243 missense probably benign 0.01
Z1176:Adam6a UTSW 12 113545321 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- CTGCAATCCATGGTCACTGTG -3'
(R):5'- CCGCATATGAAGATTGGTCAGATAG -3'

Sequencing Primer
(F):5'- GCAATCCATGGTCACTGTGGATAC -3'
(R):5'- TGGTCAGATAGGTGTCCATTAAAC -3'
Posted On 2019-11-12