Incidental Mutation 'R7676:Vcan'
ID 592472
Institutional Source Beutler Lab
Gene Symbol Vcan
Ensembl Gene ENSMUSG00000021614
Gene Name versican
Synonyms PG-M, hdf, heart defect, Cspg2, DPEAAE, 5430420N07Rik
MMRRC Submission 045647-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7676 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 89803431-89890628 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 89839908 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 1879 (S1879T)
Ref Sequence ENSEMBL: ENSMUSP00000105173 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109543] [ENSMUST00000109544] [ENSMUST00000109546] [ENSMUST00000159910]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000109543
SMART Domains Protein: ENSMUSP00000105170
Gene: ENSMUSG00000021614

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 29 148 1.4e-7 SMART
LINK 148 245 1.4e-53 SMART
LINK 249 347 8.8e-60 SMART
EGF 351 384 2.72e-7 SMART
EGF_CA 386 422 1.16e-10 SMART
CLECT 428 549 3.08e-34 SMART
CCP 555 611 1.04e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109544
SMART Domains Protein: ENSMUSP00000105171
Gene: ENSMUSG00000021614

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 29 148 1.4e-7 SMART
LINK 148 245 1.4e-53 SMART
LINK 249 347 8.8e-60 SMART
low complexity region 728 743 N/A INTRINSIC
low complexity region 1205 1219 N/A INTRINSIC
EGF 1311 1344 2.72e-7 SMART
EGF_CA 1346 1382 1.16e-10 SMART
CLECT 1388 1509 3.08e-34 SMART
CCP 1515 1571 1.04e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109546
AA Change: S1879T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105173
Gene: ENSMUSG00000021614
AA Change: S1879T

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 29 148 1.4e-7 SMART
LINK 148 245 1.4e-53 SMART
LINK 249 347 8.8e-60 SMART
low complexity region 728 743 N/A INTRINSIC
low complexity region 1205 1219 N/A INTRINSIC
low complexity region 1322 1333 N/A INTRINSIC
low complexity region 1546 1569 N/A INTRINSIC
low complexity region 1837 1852 N/A INTRINSIC
low complexity region 2013 2026 N/A INTRINSIC
low complexity region 2354 2367 N/A INTRINSIC
low complexity region 2468 2482 N/A INTRINSIC
low complexity region 2719 2728 N/A INTRINSIC
EGF 3050 3083 2.72e-7 SMART
EGF_CA 3085 3121 1.16e-10 SMART
CLECT 3127 3248 3.08e-34 SMART
CCP 3254 3310 1.04e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000159910
AA Change: S919T

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000125446
Gene: ENSMUSG00000021614
AA Change: S919T

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 29 148 1.4e-7 SMART
LINK 148 245 1.4e-53 SMART
LINK 249 347 8.8e-60 SMART
low complexity region 362 373 N/A INTRINSIC
low complexity region 586 609 N/A INTRINSIC
low complexity region 877 892 N/A INTRINSIC
low complexity region 1053 1066 N/A INTRINSIC
low complexity region 1394 1407 N/A INTRINSIC
low complexity region 1508 1522 N/A INTRINSIC
low complexity region 1759 1768 N/A INTRINSIC
EGF 2090 2123 2.72e-7 SMART
EGF_CA 2125 2161 1.16e-10 SMART
CLECT 2167 2288 3.08e-34 SMART
CCP 2294 2350 1.04e-8 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the aggrecan/versican proteoglycan family. The protein encoded is a large chondroitin sulfate proteoglycan and is a major component of the extracellular matrix. This protein is involved in cell adhesion, proliferation, proliferation, migration and angiogenesis and plays a central role in tissue morphogenesis and maintenance. Mutations in this gene are the cause of Wagner syndrome type 1. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2009]
PHENOTYPE: Homozygotes for an insertional mutation exhibit anterior-posterior segmental defects of the heart, lack endocardial cushions of the conus and atrioventricular region, and die and around embryonic day 10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca A G 11: 84,185,813 (GRCm39) D116G possibly damaging Het
Adam6a G A 12: 113,508,196 (GRCm39) G190S probably benign Het
Adnp G A 2: 168,025,367 (GRCm39) R643* probably null Het
Akap6 A G 12: 52,933,633 (GRCm39) D375G possibly damaging Het
Aldh1l2 G T 10: 83,343,975 (GRCm39) A480E probably benign Het
Ccdc175 T A 12: 72,148,821 (GRCm39) Q779L possibly damaging Het
Dnah7b T G 1: 46,273,324 (GRCm39) L2484* probably null Het
Dnajc21 T C 15: 10,462,430 (GRCm39) Y65C possibly damaging Het
Dnhd1 C A 7: 105,333,294 (GRCm39) N255K probably benign Het
Efhc1 G T 1: 21,037,593 (GRCm39) G257W probably damaging Het
Fars2 C A 13: 36,389,026 (GRCm39) L172I probably benign Het
Fat4 T C 3: 38,945,846 (GRCm39) Y1580H probably damaging Het
Fli1 T A 9: 32,339,326 (GRCm39) N253Y probably benign Het
Foxd3 G T 4: 99,545,151 (GRCm39) C97F probably damaging Het
Gem C A 4: 11,711,170 (GRCm39) D120E possibly damaging Het
Ighv10-3 A G 12: 114,487,299 (GRCm39) C41R probably damaging Het
Katnip A G 7: 125,449,549 (GRCm39) D897G probably benign Het
Kcnab3 A G 11: 69,217,553 (GRCm39) S16G probably benign Het
Keg1 T G 19: 12,693,409 (GRCm39) V154G probably benign Het
Lrrc45 G A 11: 120,611,148 (GRCm39) R602H probably damaging Het
Ltbp1 A G 17: 75,598,292 (GRCm39) D591G possibly damaging Het
Mmp10 T A 9: 7,503,550 (GRCm39) V140D probably damaging Het
Nat8f2 A T 6: 85,845,194 (GRCm39) M56K probably benign Het
Nckipsd T C 9: 108,692,153 (GRCm39) F525L probably damaging Het
Or10ak7 A G 4: 118,791,347 (GRCm39) S233P probably damaging Het
Or10j7 T A 1: 173,011,120 (GRCm39) K294* probably null Het
Or6c6c G T 10: 129,541,155 (GRCm39) S136I possibly damaging Het
P2ry12 T A 3: 59,125,178 (GRCm39) M166L possibly damaging Het
Palm3 T C 8: 84,756,074 (GRCm39) S529P possibly damaging Het
Pdilt A T 7: 119,094,220 (GRCm39) Y344N probably damaging Het
Pip4k2b A T 11: 97,611,188 (GRCm39) N309K probably benign Het
Pkd1l1 C T 11: 8,912,708 (GRCm39) V166I Het
Plxdc2 C T 2: 16,716,894 (GRCm39) S377L probably benign Het
Rc3h2 A T 2: 37,295,344 (GRCm39) V224E possibly damaging Het
Stk32c T A 7: 138,685,220 (GRCm39) D428V possibly damaging Het
Ttn T C 2: 76,644,951 (GRCm39) D12968G probably damaging Het
Tulp2 G T 7: 45,170,451 (GRCm39) V457F possibly damaging Het
Vmn1r51 T C 6: 90,106,437 (GRCm39) Y118H probably benign Het
Zfat A C 15: 68,096,693 (GRCm39) V40G possibly damaging Het
Other mutations in Vcan
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Vcan APN 13 89,852,821 (GRCm39) missense probably damaging 1.00
IGL00502:Vcan APN 13 89,840,438 (GRCm39) missense probably benign
IGL00504:Vcan APN 13 89,839,394 (GRCm39) missense possibly damaging 0.70
IGL00566:Vcan APN 13 89,837,098 (GRCm39) missense probably benign 0.01
IGL00701:Vcan APN 13 89,851,845 (GRCm39) missense probably benign
IGL00743:Vcan APN 13 89,873,425 (GRCm39) missense probably damaging 0.98
IGL00962:Vcan APN 13 89,810,171 (GRCm39) missense probably damaging 1.00
IGL01085:Vcan APN 13 89,828,077 (GRCm39) missense probably damaging 1.00
IGL01317:Vcan APN 13 89,839,787 (GRCm39) missense probably benign 0.00
IGL01349:Vcan APN 13 89,852,062 (GRCm39) missense probably damaging 0.98
IGL01391:Vcan APN 13 89,852,288 (GRCm39) missense probably benign 0.19
IGL01644:Vcan APN 13 89,836,794 (GRCm39) missense probably benign 0.13
IGL01657:Vcan APN 13 89,838,705 (GRCm39) missense probably damaging 1.00
IGL01707:Vcan APN 13 89,837,864 (GRCm39) missense probably damaging 1.00
IGL01764:Vcan APN 13 89,873,507 (GRCm39) missense probably damaging 1.00
IGL01920:Vcan APN 13 89,837,324 (GRCm39) missense probably benign 0.04
IGL01989:Vcan APN 13 89,837,478 (GRCm39) missense possibly damaging 0.86
IGL01999:Vcan APN 13 89,832,557 (GRCm39) missense probably damaging 1.00
IGL02083:Vcan APN 13 89,873,684 (GRCm39) missense probably damaging 1.00
IGL02160:Vcan APN 13 89,832,612 (GRCm39) missense probably damaging 1.00
IGL02217:Vcan APN 13 89,851,196 (GRCm39) missense probably damaging 1.00
IGL02522:Vcan APN 13 89,852,968 (GRCm39) missense probably benign 0.00
IGL02527:Vcan APN 13 89,838,776 (GRCm39) missense possibly damaging 0.95
IGL02926:Vcan APN 13 89,836,742 (GRCm39) missense probably damaging 0.98
IGL03061:Vcan APN 13 89,851,394 (GRCm39) missense probably benign 0.25
IGL03331:Vcan APN 13 89,810,051 (GRCm39) missense probably damaging 1.00
IGL03352:Vcan APN 13 89,853,125 (GRCm39) missense probably benign 0.00
R0041:Vcan UTSW 13 89,810,104 (GRCm39) missense probably damaging 1.00
R0102:Vcan UTSW 13 89,851,787 (GRCm39) missense probably benign 0.01
R0102:Vcan UTSW 13 89,851,787 (GRCm39) missense probably benign 0.01
R0109:Vcan UTSW 13 89,826,192 (GRCm39) critical splice donor site probably null
R0139:Vcan UTSW 13 89,839,380 (GRCm39) missense probably damaging 1.00
R0295:Vcan UTSW 13 89,860,310 (GRCm39) missense probably benign 0.06
R0375:Vcan UTSW 13 89,839,394 (GRCm39) missense probably damaging 0.99
R0379:Vcan UTSW 13 89,851,665 (GRCm39) missense probably damaging 0.99
R0457:Vcan UTSW 13 89,851,318 (GRCm39) missense possibly damaging 0.78
R0482:Vcan UTSW 13 89,826,264 (GRCm39) missense probably damaging 1.00
R0485:Vcan UTSW 13 89,852,779 (GRCm39) missense possibly damaging 0.92
R0532:Vcan UTSW 13 89,851,891 (GRCm39) missense probably damaging 0.99
R0561:Vcan UTSW 13 89,879,583 (GRCm39) missense possibly damaging 0.86
R0561:Vcan UTSW 13 89,860,372 (GRCm39) missense probably damaging 1.00
R0636:Vcan UTSW 13 89,860,386 (GRCm39) missense probably damaging 1.00
R0636:Vcan UTSW 13 89,852,825 (GRCm39) missense probably damaging 0.99
R0680:Vcan UTSW 13 89,827,941 (GRCm39) missense probably damaging 1.00
R0849:Vcan UTSW 13 89,853,072 (GRCm39) missense possibly damaging 0.75
R1006:Vcan UTSW 13 89,833,196 (GRCm39) critical splice donor site probably null
R1104:Vcan UTSW 13 89,840,529 (GRCm39) missense probably damaging 1.00
R1118:Vcan UTSW 13 89,853,782 (GRCm39) missense probably damaging 1.00
R1137:Vcan UTSW 13 89,852,422 (GRCm39) missense probably damaging 1.00
R1199:Vcan UTSW 13 89,827,913 (GRCm39) splice site probably null
R1219:Vcan UTSW 13 89,828,023 (GRCm39) missense probably damaging 1.00
R1296:Vcan UTSW 13 89,805,675 (GRCm39) missense probably damaging 1.00
R1332:Vcan UTSW 13 89,841,174 (GRCm39) missense probably damaging 1.00
R1336:Vcan UTSW 13 89,841,174 (GRCm39) missense probably damaging 1.00
R1403:Vcan UTSW 13 89,836,603 (GRCm39) missense probably benign 0.00
R1403:Vcan UTSW 13 89,836,603 (GRCm39) missense probably benign 0.00
R1546:Vcan UTSW 13 89,841,075 (GRCm39) missense probably damaging 0.99
R1604:Vcan UTSW 13 89,837,780 (GRCm39) missense probably benign 0.42
R1616:Vcan UTSW 13 89,853,782 (GRCm39) missense probably damaging 1.00
R1636:Vcan UTSW 13 89,851,786 (GRCm39) missense possibly damaging 0.90
R1654:Vcan UTSW 13 89,810,065 (GRCm39) missense probably damaging 1.00
R1680:Vcan UTSW 13 89,851,666 (GRCm39) missense probably benign 0.19
R1694:Vcan UTSW 13 89,836,602 (GRCm39) missense probably damaging 0.98
R1712:Vcan UTSW 13 89,869,894 (GRCm39) missense probably damaging 1.00
R1754:Vcan UTSW 13 89,852,854 (GRCm39) missense probably benign 0.01
R1756:Vcan UTSW 13 89,839,800 (GRCm39) missense probably benign 0.05
R1824:Vcan UTSW 13 89,853,331 (GRCm39) missense possibly damaging 0.75
R1852:Vcan UTSW 13 89,853,511 (GRCm39) missense probably damaging 0.99
R1868:Vcan UTSW 13 89,838,990 (GRCm39) missense probably benign 0.12
R1920:Vcan UTSW 13 89,841,134 (GRCm39) missense probably damaging 1.00
R1932:Vcan UTSW 13 89,853,653 (GRCm39) missense possibly damaging 0.78
R1934:Vcan UTSW 13 89,851,045 (GRCm39) missense probably damaging 1.00
R1942:Vcan UTSW 13 89,851,543 (GRCm39) missense probably benign 0.01
R1964:Vcan UTSW 13 89,840,861 (GRCm39) missense probably benign 0.02
R1970:Vcan UTSW 13 89,837,157 (GRCm39) missense probably damaging 1.00
R2045:Vcan UTSW 13 89,839,104 (GRCm39) missense probably benign 0.00
R2110:Vcan UTSW 13 89,841,422 (GRCm39) missense probably damaging 1.00
R2111:Vcan UTSW 13 89,841,422 (GRCm39) missense probably damaging 1.00
R2112:Vcan UTSW 13 89,841,422 (GRCm39) missense probably damaging 1.00
R2136:Vcan UTSW 13 89,837,856 (GRCm39) missense probably damaging 1.00
R2158:Vcan UTSW 13 89,851,648 (GRCm39) missense possibly damaging 0.68
R2376:Vcan UTSW 13 89,851,529 (GRCm39) missense possibly damaging 0.80
R2385:Vcan UTSW 13 89,837,568 (GRCm39) missense probably damaging 1.00
R2443:Vcan UTSW 13 89,852,794 (GRCm39) missense probably damaging 1.00
R2876:Vcan UTSW 13 89,852,356 (GRCm39) missense probably damaging 1.00
R3607:Vcan UTSW 13 89,851,420 (GRCm39) missense probably damaging 0.98
R4042:Vcan UTSW 13 89,840,662 (GRCm39) missense probably benign 0.35
R4043:Vcan UTSW 13 89,840,662 (GRCm39) missense probably benign 0.35
R4044:Vcan UTSW 13 89,840,662 (GRCm39) missense probably benign 0.35
R4065:Vcan UTSW 13 89,828,006 (GRCm39) missense probably damaging 1.00
R4161:Vcan UTSW 13 89,833,277 (GRCm39) missense probably damaging 1.00
R4178:Vcan UTSW 13 89,873,666 (GRCm39) missense probably damaging 1.00
R4290:Vcan UTSW 13 89,873,605 (GRCm39) missense probably damaging 1.00
R4530:Vcan UTSW 13 89,852,147 (GRCm39) missense probably damaging 0.97
R4666:Vcan UTSW 13 89,828,053 (GRCm39) missense probably damaging 1.00
R4785:Vcan UTSW 13 89,853,908 (GRCm39) missense probably damaging 1.00
R4870:Vcan UTSW 13 89,852,858 (GRCm39) missense probably benign 0.01
R4973:Vcan UTSW 13 89,836,961 (GRCm39) missense probably benign 0.30
R5037:Vcan UTSW 13 89,852,096 (GRCm39) missense probably damaging 1.00
R5104:Vcan UTSW 13 89,805,591 (GRCm39) intron probably benign
R5124:Vcan UTSW 13 89,873,636 (GRCm39) missense probably damaging 1.00
R5129:Vcan UTSW 13 89,838,359 (GRCm39) missense probably damaging 1.00
R5198:Vcan UTSW 13 89,838,991 (GRCm39) missense probably damaging 1.00
R5240:Vcan UTSW 13 89,840,651 (GRCm39) missense probably benign 0.08
R5254:Vcan UTSW 13 89,839,719 (GRCm39) missense probably damaging 0.99
R5280:Vcan UTSW 13 89,838,405 (GRCm39) missense probably benign 0.00
R5522:Vcan UTSW 13 89,839,929 (GRCm39) missense possibly damaging 0.62
R5557:Vcan UTSW 13 89,851,231 (GRCm39) missense possibly damaging 0.77
R5568:Vcan UTSW 13 89,836,790 (GRCm39) missense probably damaging 1.00
R5578:Vcan UTSW 13 89,839,622 (GRCm39) missense probably benign 0.01
R5627:Vcan UTSW 13 89,839,254 (GRCm39) frame shift probably null
R5687:Vcan UTSW 13 89,826,253 (GRCm39) missense probably damaging 1.00
R5752:Vcan UTSW 13 89,828,069 (GRCm39) missense probably damaging 1.00
R5879:Vcan UTSW 13 89,852,071 (GRCm39) missense probably damaging 0.99
R5941:Vcan UTSW 13 89,840,810 (GRCm39) missense probably damaging 0.98
R6113:Vcan UTSW 13 89,805,655 (GRCm39) nonsense probably null
R6135:Vcan UTSW 13 89,838,045 (GRCm39) missense probably benign 0.36
R6252:Vcan UTSW 13 89,839,339 (GRCm39) nonsense probably null
R6280:Vcan UTSW 13 89,873,492 (GRCm39) missense probably damaging 1.00
R6317:Vcan UTSW 13 89,839,716 (GRCm39) missense probably benign 0.22
R6327:Vcan UTSW 13 89,852,951 (GRCm39) missense probably damaging 0.99
R6460:Vcan UTSW 13 89,838,806 (GRCm39) missense possibly damaging 0.61
R6669:Vcan UTSW 13 89,852,850 (GRCm39) missense probably benign 0.21
R6744:Vcan UTSW 13 89,853,301 (GRCm39) missense probably damaging 1.00
R6819:Vcan UTSW 13 89,853,244 (GRCm39) missense probably benign 0.00
R6880:Vcan UTSW 13 89,860,500 (GRCm39) missense probably damaging 1.00
R6956:Vcan UTSW 13 89,837,550 (GRCm39) missense probably damaging 0.99
R6971:Vcan UTSW 13 89,826,252 (GRCm39) missense probably damaging 1.00
R6985:Vcan UTSW 13 89,828,075 (GRCm39) missense probably damaging 1.00
R6994:Vcan UTSW 13 89,841,526 (GRCm39) missense possibly damaging 0.94
R6997:Vcan UTSW 13 89,838,737 (GRCm39) missense probably damaging 0.98
R7029:Vcan UTSW 13 89,838,360 (GRCm39) missense probably damaging 1.00
R7066:Vcan UTSW 13 89,853,805 (GRCm39) missense probably damaging 1.00
R7156:Vcan UTSW 13 89,837,229 (GRCm39) missense possibly damaging 0.95
R7171:Vcan UTSW 13 89,873,710 (GRCm39) missense probably damaging 1.00
R7176:Vcan UTSW 13 89,837,055 (GRCm39) missense probably benign 0.01
R7229:Vcan UTSW 13 89,853,389 (GRCm39) missense possibly damaging 0.87
R7250:Vcan UTSW 13 89,879,576 (GRCm39) critical splice donor site probably null
R7250:Vcan UTSW 13 89,869,805 (GRCm39) missense probably damaging 1.00
R7262:Vcan UTSW 13 89,853,280 (GRCm39) missense possibly damaging 0.62
R7289:Vcan UTSW 13 89,840,852 (GRCm39) nonsense probably null
R7299:Vcan UTSW 13 89,853,385 (GRCm39) missense probably benign
R7301:Vcan UTSW 13 89,853,385 (GRCm39) missense probably benign
R7425:Vcan UTSW 13 89,837,951 (GRCm39) missense probably damaging 0.99
R7514:Vcan UTSW 13 89,852,237 (GRCm39) missense probably damaging 0.97
R7579:Vcan UTSW 13 89,840,577 (GRCm39) missense probably damaging 1.00
R7618:Vcan UTSW 13 89,840,342 (GRCm39) missense probably damaging 0.99
R7655:Vcan UTSW 13 89,833,233 (GRCm39) missense probably damaging 1.00
R7656:Vcan UTSW 13 89,833,233 (GRCm39) missense probably damaging 1.00
R7719:Vcan UTSW 13 89,852,738 (GRCm39) missense probably damaging 0.98
R7753:Vcan UTSW 13 89,837,442 (GRCm39) missense probably damaging 1.00
R7762:Vcan UTSW 13 89,841,056 (GRCm39) missense probably damaging 1.00
R7778:Vcan UTSW 13 89,836,773 (GRCm39) missense probably damaging 1.00
R7824:Vcan UTSW 13 89,836,773 (GRCm39) missense probably damaging 1.00
R7995:Vcan UTSW 13 89,839,977 (GRCm39) missense probably benign
R7998:Vcan UTSW 13 89,852,446 (GRCm39) missense probably damaging 1.00
R8033:Vcan UTSW 13 89,852,479 (GRCm39) missense probably benign 0.04
R8061:Vcan UTSW 13 89,805,409 (GRCm39) missense probably benign 0.45
R8103:Vcan UTSW 13 89,851,439 (GRCm39) nonsense probably null
R8103:Vcan UTSW 13 89,805,777 (GRCm39) missense probably damaging 1.00
R8124:Vcan UTSW 13 89,852,373 (GRCm39) missense possibly damaging 0.93
R8162:Vcan UTSW 13 89,853,106 (GRCm39) nonsense probably null
R8166:Vcan UTSW 13 89,840,855 (GRCm39) missense probably benign 0.02
R8274:Vcan UTSW 13 89,853,089 (GRCm39) missense probably benign 0.02
R8284:Vcan UTSW 13 89,852,454 (GRCm39) missense possibly damaging 0.68
R8417:Vcan UTSW 13 89,836,862 (GRCm39) missense probably benign 0.19
R8696:Vcan UTSW 13 89,839,217 (GRCm39) missense probably benign 0.00
R8738:Vcan UTSW 13 89,840,439 (GRCm39) missense probably benign 0.17
R8792:Vcan UTSW 13 89,840,230 (GRCm39) missense possibly damaging 0.91
R8887:Vcan UTSW 13 89,853,026 (GRCm39) missense probably benign
R9049:Vcan UTSW 13 89,826,224 (GRCm39) missense probably damaging 1.00
R9074:Vcan UTSW 13 89,839,146 (GRCm39) missense possibly damaging 0.95
R9095:Vcan UTSW 13 89,852,644 (GRCm39) missense probably benign 0.32
R9172:Vcan UTSW 13 89,828,050 (GRCm39) missense probably damaging 1.00
R9199:Vcan UTSW 13 89,838,615 (GRCm39) nonsense probably null
R9259:Vcan UTSW 13 89,838,989 (GRCm39) missense probably damaging 0.99
R9455:Vcan UTSW 13 89,837,452 (GRCm39) missense probably damaging 1.00
R9476:Vcan UTSW 13 89,851,531 (GRCm39) missense possibly damaging 0.95
R9477:Vcan UTSW 13 89,841,128 (GRCm39) missense probably damaging 1.00
R9555:Vcan UTSW 13 89,839,659 (GRCm39) missense
R9579:Vcan UTSW 13 89,837,713 (GRCm39) missense possibly damaging 0.67
R9606:Vcan UTSW 13 89,853,491 (GRCm39) missense probably damaging 1.00
R9645:Vcan UTSW 13 89,841,081 (GRCm39) missense probably benign 0.00
R9659:Vcan UTSW 13 89,839,860 (GRCm39) missense probably damaging 0.99
R9766:Vcan UTSW 13 89,839,247 (GRCm39) missense probably benign 0.00
R9778:Vcan UTSW 13 89,837,930 (GRCm39) missense probably damaging 1.00
X0058:Vcan UTSW 13 89,840,612 (GRCm39) missense probably benign 0.21
X0065:Vcan UTSW 13 89,853,868 (GRCm39) missense probably damaging 0.96
Z1176:Vcan UTSW 13 89,840,690 (GRCm39) missense probably benign 0.10
Z1177:Vcan UTSW 13 89,852,192 (GRCm39) missense probably damaging 1.00
Z1177:Vcan UTSW 13 89,851,907 (GRCm39) nonsense probably null
Z1177:Vcan UTSW 13 89,851,643 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AACTCGTTCATCGTCAGAACC -3'
(R):5'- TTTTACGGACCTGGGCTCAG -3'

Sequencing Primer
(F):5'- GTTCATCGTCAGAACCTCCCATC -3'
(R):5'- GTACTGGTATGGAACTCATCACTGC -3'
Posted On 2019-11-12