Mutagenetix > Incidental Mutation

Incidental Mutation 'R7676:Zfat'

592474

Institutional Source

Beutler Lab

Gene Symbol

Zfat

Ensembl Gene

ENSMUSG00000022335

Gene Name

zinc finger and AT hook domain containing

Synonyms

LOC380993, Zfat1, Zfp406

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7676 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

68083764-68258856 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 68224844 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glycine at position 40 (V40G)

Ref Sequence

ENSEMBL: ENSMUSP00000125257 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000160248] [ENSMUST00000162054] [ENSMUST00000162173]

AlphaFold

Q7TS63

Predicted Effect

possibly damaging
Transcript: ENSMUST00000160248
AA Change: V40G

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000125257
Gene: ENSMUSG00000022335
AA Change: V40G

Domain	Start	End	E-Value	Type
ZnF_C2H2	12	35	2.45e0	SMART
ZnF_C2H2	116	136	1.53e2	SMART
low complexity region	220	236	N/A	INTRINSIC
ZnF_C2H2	271	293	1.47e-3	SMART
ZnF_C2H2	299	321	1.18e-2	SMART
ZnF_C2H2	326	349	2.36e-2	SMART
ZnF_C2H2	354	377	4.4e-2	SMART
ZnF_C2H2	404	426	1.67e-2	SMART
ZnF_C2H2	432	454	1.33e-1	SMART
ZnF_C2H2	458	481	2.05e-2	SMART
low complexity region	601	617	N/A	INTRINSIC
ZnF_C2H2	737	759	1.43e-1	SMART
ZnF_C2H2	765	788	3.52e-1	SMART
ZnF_C2H2	793	817	5.59e-4	SMART
ZnF_C2H2	825	848	3.83e-2	SMART
ZnF_C2H2	875	898	3.95e1	SMART
ZnF_C2H2	904	926	6.88e-4	SMART
ZnF_C2H2	932	954	8.94e-3	SMART
ZnF_C2H2	961	983	2.27e-4	SMART
ZnF_C2H2	989	1012	9.3e-1	SMART
ZnF_C2H2	1036	1059	5.21e-4	SMART
low complexity region	1073	1082	N/A	INTRINSIC
low complexity region	1139	1149	N/A	INTRINSIC
low complexity region	1218	1236	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000162054
AA Change: V40G

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000125732
Gene: ENSMUSG00000022335
AA Change: V40G

Domain	Start	End	E-Value	Type
ZnF_C2H2	12	35	2.45e0	SMART
ZnF_C2H2	116	136	1.53e2	SMART
low complexity region	213	229	N/A	INTRINSIC
ZnF_C2H2	264	286	1.47e-3	SMART
ZnF_C2H2	292	314	1.18e-2	SMART
ZnF_C2H2	319	342	2.36e-2	SMART
ZnF_C2H2	347	370	4.4e-2	SMART
ZnF_C2H2	397	419	1.67e-2	SMART
ZnF_C2H2	425	447	1.33e-1	SMART
ZnF_C2H2	451	474	2.05e-2	SMART
low complexity region	594	610	N/A	INTRINSIC
ZnF_C2H2	730	752	1.43e-1	SMART
ZnF_C2H2	758	781	3.52e-1	SMART
ZnF_C2H2	786	810	5.59e-4	SMART
ZnF_C2H2	818	841	3.83e-2	SMART
ZnF_C2H2	868	891	3.95e1	SMART
ZnF_C2H2	897	919	6.88e-4	SMART
ZnF_C2H2	925	947	8.94e-3	SMART
ZnF_C2H2	954	976	2.27e-4	SMART
ZnF_C2H2	982	1005	9.3e-1	SMART
ZnF_C2H2	1029	1052	5.21e-4	SMART
low complexity region	1121	1131	N/A	INTRINSIC
low complexity region	1200	1218	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000162173
AA Change: V40G

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000124974
Gene: ENSMUSG00000022335
AA Change: V40G

Domain	Start	End	E-Value	Type
ZnF_C2H2	12	35	2.45e0	SMART
ZnF_C2H2	116	136	1.53e2	SMART
low complexity region	220	236	N/A	INTRINSIC
ZnF_C2H2	271	293	1.47e-3	SMART
ZnF_C2H2	299	321	1.18e-2	SMART
ZnF_C2H2	326	349	2.36e-2	SMART
ZnF_C2H2	354	377	4.4e-2	SMART
ZnF_C2H2	404	426	1.67e-2	SMART
ZnF_C2H2	432	454	1.33e-1	SMART
ZnF_C2H2	458	481	2.05e-2	SMART
low complexity region	601	617	N/A	INTRINSIC
ZnF_C2H2	737	759	1.43e-1	SMART
ZnF_C2H2	765	788	3.52e-1	SMART
ZnF_C2H2	793	817	5.59e-4	SMART
ZnF_C2H2	825	848	3.83e-2	SMART
ZnF_C2H2	875	898	3.95e1	SMART
ZnF_C2H2	904	926	6.88e-4	SMART
ZnF_C2H2	932	954	8.94e-3	SMART
ZnF_C2H2	961	983	2.27e-4	SMART
ZnF_C2H2	989	1012	9.3e-1	SMART
ZnF_C2H2	1036	1059	5.21e-4	SMART
low complexity region	1133	1151	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that likely binds DNA and functions as a transcriptional regulator involved in apoptosis and cell survival. This gene resides in a susceptibility locus for autoimmune thyroid disease (AITD) on chromosome 8q24. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete embryonic lethality associated with failure to initiation of embryo turning, abnormal embryonic hematopoiesis, abnormal spongiotrophoblast layer morphology, abnormal visceral yolk sac blood island morphology and pale yolk sac. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acaca	A	G	11: 84,294,987	D116G	possibly damaging	Het
Adam6a	G	A	12: 113,544,576	G190S	probably benign	Het
Adnp	G	A	2: 168,183,447	R643*	probably null	Het
Akap6	A	G	12: 52,886,850	D375G	possibly damaging	Het
Aldh1l2	G	T	10: 83,508,111	A480E	probably benign	Het
Ccdc175	T	A	12: 72,102,047	Q779L	possibly damaging	Het
D430042O09Rik	A	G	7: 125,850,377	D897G	probably benign	Het
Dnah7b	T	G	1: 46,234,164	L2484*	probably null	Het
Dnajc21	T	C	15: 10,462,344	Y65C	possibly damaging	Het
Dnhd1	C	A	7: 105,684,087	N255K	probably benign	Het
Efhc1	G	T	1: 20,967,369	G257W	probably damaging	Het
Fars2	C	A	13: 36,205,043	L172I	probably benign	Het
Fat4	T	C	3: 38,891,697	Y1580H	probably damaging	Het
Fli1	T	A	9: 32,428,030	N253Y	probably benign	Het
Foxd3	G	T	4: 99,656,914	C97F	probably damaging	Het
Gem	C	A	4: 11,711,170	D120E	possibly damaging	Het
Ighv10-3	A	G	12: 114,523,679	C41R	probably damaging	Het
Kcnab3	A	G	11: 69,326,727	S16G	probably benign	Het
Keg1	T	G	19: 12,716,045	V154G	probably benign	Het
Lrrc45	G	A	11: 120,720,322	R602H	probably damaging	Het
Ltbp1	A	G	17: 75,291,297	D591G	possibly damaging	Het
Mmp10	T	A	9: 7,503,549	V140D	probably damaging	Het
Nat8f2	A	T	6: 85,868,212	M56K	probably benign	Het
Nckipsd	T	C	9: 108,814,954	F525L	probably damaging	Het
Olfr1328	A	G	4: 118,934,150	S233P	probably damaging	Het
Olfr1406	T	A	1: 173,183,553	K294*	probably null	Het
Olfr804	G	T	10: 129,705,286	S136I	possibly damaging	Het
P2ry12	T	A	3: 59,217,757	M166L	possibly damaging	Het
Palm3	T	C	8: 84,029,445	S529P	possibly damaging	Het
Pdilt	A	T	7: 119,494,997	Y344N	probably damaging	Het
Pip4k2b	A	T	11: 97,720,362	N309K	probably benign	Het
Pkd1l1	C	T	11: 8,962,708	V166I		Het
Plxdc2	C	T	2: 16,712,083	S377L	probably benign	Het
Rc3h2	A	T	2: 37,405,332	V224E	possibly damaging	Het
Stk32c	T	A	7: 139,105,304	D428V	possibly damaging	Het
Ttn	T	C	2: 76,814,607	D12968G	probably damaging	Het
Tulp2	G	T	7: 45,521,027	V457F	possibly damaging	Het
Vcan	A	T	13: 89,691,789	S1879T	probably damaging	Het
Vmn1r51	T	C	6: 90,129,455	Y118H	probably benign	Het

Other mutations in Zfat

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00542:Zfat	APN	15	68170222	missense	possibly damaging	0.92
IGL00862:Zfat	APN	15	68258663	splice site	probably null
IGL01021:Zfat	APN	15	68170166	missense	possibly damaging	0.50
IGL01152:Zfat	APN	15	68110504	missense	probably damaging	1.00
IGL01733:Zfat	APN	15	68180730	missense	probably damaging	1.00
IGL01873:Zfat	APN	15	68224895	missense	probably benign	0.00
IGL01990:Zfat	APN	15	68224817	missense	probably damaging	1.00
IGL02066:Zfat	APN	15	68180829	missense	probably damaging	1.00
IGL02664:Zfat	APN	15	68180721	missense	probably damaging	1.00
IGL02955:Zfat	APN	15	68181114	missense	probably damaging	0.98
IGL03201:Zfat	APN	15	68165909	missense	probably damaging	1.00
R0145:Zfat	UTSW	15	68187099	missense	possibly damaging	0.95
R0408:Zfat	UTSW	15	68180292	missense	probably benign	0.10
R0633:Zfat	UTSW	15	68180803	missense	probably damaging	1.00
R1147:Zfat	UTSW	15	68212583	splice site	probably benign
R1508:Zfat	UTSW	15	68178751	missense	probably damaging	1.00
R1513:Zfat	UTSW	15	68212680	missense	probably damaging	1.00
R1641:Zfat	UTSW	15	68180110	missense	probably benign	0.19
R1889:Zfat	UTSW	15	68101539	missense	probably benign	0.00
R1959:Zfat	UTSW	15	68146543	missense	probably benign	0.32
R2030:Zfat	UTSW	15	68118934	critical splice donor site	probably null
R2202:Zfat	UTSW	15	68179860	missense	probably benign	0.36
R2340:Zfat	UTSW	15	68101541	missense	probably damaging	0.99
R3440:Zfat	UTSW	15	68084553	missense	probably benign	0.00
R3442:Zfat	UTSW	15	68084553	missense	probably benign	0.00
R3442:Zfat	UTSW	15	68101581	missense	probably damaging	0.99
R4406:Zfat	UTSW	15	68180191	missense	probably benign	0.00
R4649:Zfat	UTSW	15	68184476	missense	probably damaging	1.00
R4710:Zfat	UTSW	15	68180282	missense	probably benign
R4712:Zfat	UTSW	15	68110475	critical splice donor site	probably null
R4745:Zfat	UTSW	15	68180374	missense	probably benign	0.09
R4862:Zfat	UTSW	15	68180110	missense	probably benign	0.02
R5015:Zfat	UTSW	15	68178913	missense	probably damaging	1.00
R5075:Zfat	UTSW	15	68180230	missense	probably benign
R5208:Zfat	UTSW	15	68180721	missense	probably damaging	1.00
R5277:Zfat	UTSW	15	68165909	missense	probably damaging	1.00
R5303:Zfat	UTSW	15	68110486	missense	probably damaging	1.00
R5328:Zfat	UTSW	15	68179828	missense	probably damaging	0.99
R5642:Zfat	UTSW	15	68180916	missense	probably damaging	1.00
R5659:Zfat	UTSW	15	68119013	missense	probably damaging	1.00
R5947:Zfat	UTSW	15	68179957	missense	probably benign
R6046:Zfat	UTSW	15	68180777	missense	probably damaging	0.99
R6315:Zfat	UTSW	15	68084462	missense	probably damaging	1.00
R6342:Zfat	UTSW	15	68180982	missense	probably damaging	1.00
R6573:Zfat	UTSW	15	68165854	missense	probably damaging	1.00
R6789:Zfat	UTSW	15	68084386	missense	probably damaging	1.00
R7028:Zfat	UTSW	15	68180452	missense	probably damaging	1.00
R7033:Zfat	UTSW	15	68181015	missense	probably damaging	1.00
R7039:Zfat	UTSW	15	68180362	missense	probably benign
R7065:Zfat	UTSW	15	68181120	missense	probably damaging	1.00
R7144:Zfat	UTSW	15	68178782	missense	probably benign	0.12
R7208:Zfat	UTSW	15	68180007	missense	probably benign	0.39
R7330:Zfat	UTSW	15	68212751	missense	probably benign	0.00
R7345:Zfat	UTSW	15	68105043	missense	probably damaging	1.00
R7378:Zfat	UTSW	15	68181120	missense	probably damaging	1.00
R7405:Zfat	UTSW	15	68184485	missense	probably damaging	1.00
R7481:Zfat	UTSW	15	68178866	nonsense	probably null
R7672:Zfat	UTSW	15	68258686	start codon destroyed	probably null	0.39
R7701:Zfat	UTSW	15	68180908	nonsense	probably null
R7825:Zfat	UTSW	15	68179920	missense	probably benign	0.01
R8152:Zfat	UTSW	15	68101506	missense	probably benign	0.23
R8404:Zfat	UTSW	15	68105067	missense	probably benign	0.00
R8405:Zfat	UTSW	15	68146561	missense	probably damaging	1.00
R8502:Zfat	UTSW	15	68105067	missense	probably benign	0.00
R8534:Zfat	UTSW	15	68165847	missense	probably damaging	1.00
R8708:Zfat	UTSW	15	68084429	missense	possibly damaging	0.95
R8887:Zfat	UTSW	15	68184466	missense	probably damaging	1.00
R8896:Zfat	UTSW	15	68180670	missense	probably damaging	1.00
R8906:Zfat	UTSW	15	68084555	missense	possibly damaging	0.81
R9117:Zfat	UTSW	15	68187069	missense	probably damaging	0.98
R9137:Zfat	UTSW	15	68179945	missense	probably benign	0.00
R9310:Zfat	UTSW	15	68084401	missense	probably damaging	1.00
R9482:Zfat	UTSW	15	68212803	missense	probably damaging	1.00
R9610:Zfat	UTSW	15	68179806	missense	possibly damaging	0.58
R9611:Zfat	UTSW	15	68179806	missense	possibly damaging	0.58
R9630:Zfat	UTSW	15	68118944	missense	probably benign	0.37
Z1088:Zfat	UTSW	15	68187101	missense	probably benign	0.00
Z1177:Zfat	UTSW	15	68179828	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TTCTGCTGTGTCCATGAGC -3'
(R):5'- CTGCAAAGGGAACAGTCTGC -3'

Sequencing Primer
(F):5'- CTGTGTCCATGAGCCAGGTAG -3'
(R):5'- CAGTCTGCAGGAAGTGGAC -3'

Posted On

2019-11-12