Mutagenetix > Incidental Mutation

Incidental Mutation 'R7676:Ltbp1'

592475

Institutional Source

Beutler Lab

Gene Symbol

Ltbp1

Ensembl Gene

ENSMUSG00000001870

Gene Name

latent transforming growth factor beta binding protein 1

Synonyms

b2b1000Clo, LTBP-1, 9430031G15Rik

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7676 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

75005568-75392512 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 75291297 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 591 (D591G)

Ref Sequence

ENSEMBL: ENSMUSP00000116890 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000001927] [ENSMUST00000112514] [ENSMUST00000112516] [ENSMUST00000135447]

AlphaFold

Q8CG19

Predicted Effect

possibly damaging
Transcript: ENSMUST00000001927
AA Change: D909G

PolyPhen 2 Score 0.825 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000001927
Gene: ENSMUSG00000001870
AA Change: D909G

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
low complexity region	34	49	N/A	INTRINSIC
low complexity region	58	73	N/A	INTRINSIC
low complexity region	94	109	N/A	INTRINSIC
low complexity region	149	158	N/A	INTRINSIC
EGF	184	213	9.27e-1	SMART
EGF	394	423	2.23e-3	SMART
Pfam:TB	559	601	2.4e-9	PFAM
EGF_CA	618	658	9.39e-11	SMART
Pfam:TB	680	720	1e-18	PFAM
low complexity region	839	849	N/A	INTRINSIC
EGF_CA	865	906	5.83e-7	SMART
EGF_CA	907	948	6.39e-13	SMART
EGF_CA	949	989	4.25e-9	SMART
EGF_CA	990	1029	2.44e-9	SMART
EGF_CA	1030	1070	5.87e-12	SMART
EGF_CA	1071	1111	3.61e-12	SMART
EGF_CA	1112	1152	1.57e-12	SMART
EGF_CA	1153	1193	1.75e-10	SMART
EGF_CA	1194	1235	6.74e-12	SMART
EGF_CA	1236	1277	3.22e-9	SMART
EGF	1281	1320	2.16e1	SMART
Pfam:TB	1349	1391	5.6e-17	PFAM
EGF	1418	1457	1.14e0	SMART
EGF_CA	1458	1498	2.68e-6	SMART
Pfam:TB	1526	1567	4.2e-15	PFAM
EGF	1615	1652	1e-5	SMART
EGF_CA	1653	1697	5.11e-12	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000112514
AA Change: D538G

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000108133
Gene: ENSMUSG00000001870
AA Change: D538G

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
EGF	76	105	2.23e-3	SMART
Pfam:TB	240	283	9.5e-13	PFAM
EGF_CA	300	340	9.39e-11	SMART
Pfam:TB	361	400	3.1e-17	PFAM
low complexity region	468	478	N/A	INTRINSIC
EGF_CA	494	535	5.83e-7	SMART
EGF_CA	536	577	6.39e-13	SMART
EGF_CA	578	618	4.25e-9	SMART
EGF_CA	619	658	2.44e-9	SMART
EGF_CA	659	699	5.87e-12	SMART
EGF_CA	700	740	3.61e-12	SMART
EGF_CA	741	781	1.57e-12	SMART
EGF_CA	782	822	1.75e-10	SMART
EGF_CA	823	864	6.74e-12	SMART
EGF_CA	865	906	3.22e-9	SMART
EGF	910	949	2.16e1	SMART
Pfam:TB	977	1020	4.3e-20	PFAM
EGF	1047	1086	1.14e0	SMART
EGF_CA	1087	1127	2.68e-6	SMART
Pfam:TB	1154	1196	1.3e-17	PFAM
EGF	1244	1281	1e-5	SMART
EGF_CA	1282	1326	5.11e-12	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000112516
AA Change: D591G

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000108135
Gene: ENSMUSG00000001870
AA Change: D591G

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
EGF	76	105	2.23e-3	SMART
Pfam:TB	240	283	9.9e-13	PFAM
EGF_CA	300	340	9.39e-11	SMART
Pfam:TB	361	402	7.6e-20	PFAM
low complexity region	521	531	N/A	INTRINSIC
EGF_CA	547	588	5.83e-7	SMART
EGF_CA	589	630	6.39e-13	SMART
EGF_CA	631	671	4.25e-9	SMART
EGF_CA	672	711	2.44e-9	SMART
EGF_CA	712	752	5.87e-12	SMART
EGF_CA	753	793	3.61e-12	SMART
EGF_CA	794	834	1.57e-12	SMART
EGF_CA	835	875	1.75e-10	SMART
EGF_CA	876	917	6.74e-12	SMART
EGF_CA	918	959	3.22e-9	SMART
EGF	963	1002	2.16e1	SMART
Pfam:TB	1030	1073	4.5e-20	PFAM
EGF	1100	1139	1.14e0	SMART
EGF_CA	1140	1180	2.68e-6	SMART
Pfam:TB	1207	1249	1.4e-17	PFAM
EGF	1297	1334	1e-5	SMART
EGF_CA	1335	1379	5.11e-12	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000135447
AA Change: D591G

PolyPhen 2 Score 0.584 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000116890
Gene: ENSMUSG00000001870
AA Change: D591G

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
EGF	76	105	1.1e-5	SMART
Pfam:TB	240	283	4.3e-10	PFAM
EGF_CA	300	340	4.4e-13	SMART
Pfam:TB	361	402	3.3e-17	PFAM
low complexity region	521	531	N/A	INTRINSIC
EGF_CA	547	588	2.9e-9	SMART
EGF_CA	589	630	3e-15	SMART
EGF_CA	631	671	2.1e-11	SMART
EGF_CA	672	711	1.2e-11	SMART
EGF_CA	712	752	2.8e-14	SMART
EGF_CA	753	793	1.8e-14	SMART
EGF_CA	794	834	7.5e-15	SMART
EGF_CA	835	875	8.4e-13	SMART
EGF_CA	876	917	3.2e-14	SMART
EGF_CA	918	959	1.6e-11	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of latent TGF-beta binding proteins (LTBPs). The secretion and activation of TGF-betas is regulated by their association with latency-associated proteins and with latent TGF-beta binding proteins. The product of this gene targets latent complexes of transforming growth factor beta to the extracellular matrix, where the latent cytokine is subsequently activated by several different mechanisms. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic and neonatal lethality associated with defects in the aortic arch and outflow tract. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acaca	A	G	11: 84,294,987	D116G	possibly damaging	Het
Adam6a	G	A	12: 113,544,576	G190S	probably benign	Het
Adnp	G	A	2: 168,183,447	R643*	probably null	Het
Akap6	A	G	12: 52,886,850	D375G	possibly damaging	Het
Aldh1l2	G	T	10: 83,508,111	A480E	probably benign	Het
Ccdc175	T	A	12: 72,102,047	Q779L	possibly damaging	Het
D430042O09Rik	A	G	7: 125,850,377	D897G	probably benign	Het
Dnah7b	T	G	1: 46,234,164	L2484*	probably null	Het
Dnajc21	T	C	15: 10,462,344	Y65C	possibly damaging	Het
Dnhd1	C	A	7: 105,684,087	N255K	probably benign	Het
Efhc1	G	T	1: 20,967,369	G257W	probably damaging	Het
Fars2	C	A	13: 36,205,043	L172I	probably benign	Het
Fat4	T	C	3: 38,891,697	Y1580H	probably damaging	Het
Fli1	T	A	9: 32,428,030	N253Y	probably benign	Het
Foxd3	G	T	4: 99,656,914	C97F	probably damaging	Het
Gem	C	A	4: 11,711,170	D120E	possibly damaging	Het
Ighv10-3	A	G	12: 114,523,679	C41R	probably damaging	Het
Kcnab3	A	G	11: 69,326,727	S16G	probably benign	Het
Keg1	T	G	19: 12,716,045	V154G	probably benign	Het
Lrrc45	G	A	11: 120,720,322	R602H	probably damaging	Het
Mmp10	T	A	9: 7,503,549	V140D	probably damaging	Het
Nat8f2	A	T	6: 85,868,212	M56K	probably benign	Het
Nckipsd	T	C	9: 108,814,954	F525L	probably damaging	Het
Olfr1328	A	G	4: 118,934,150	S233P	probably damaging	Het
Olfr1406	T	A	1: 173,183,553	K294*	probably null	Het
Olfr804	G	T	10: 129,705,286	S136I	possibly damaging	Het
P2ry12	T	A	3: 59,217,757	M166L	possibly damaging	Het
Palm3	T	C	8: 84,029,445	S529P	possibly damaging	Het
Pdilt	A	T	7: 119,494,997	Y344N	probably damaging	Het
Pip4k2b	A	T	11: 97,720,362	N309K	probably benign	Het
Pkd1l1	C	T	11: 8,962,708	V166I		Het
Plxdc2	C	T	2: 16,712,083	S377L	probably benign	Het
Rc3h2	A	T	2: 37,405,332	V224E	possibly damaging	Het
Stk32c	T	A	7: 139,105,304	D428V	possibly damaging	Het
Ttn	T	C	2: 76,814,607	D12968G	probably damaging	Het
Tulp2	G	T	7: 45,521,027	V457F	possibly damaging	Het
Vcan	A	T	13: 89,691,789	S1879T	probably damaging	Het
Vmn1r51	T	C	6: 90,129,455	Y118H	probably benign	Het
Zfat	A	C	15: 68,224,844	V40G	possibly damaging	Het

Other mutations in Ltbp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00091:Ltbp1	APN	17	75225338	missense	probably damaging	1.00
IGL00156:Ltbp1	APN	17	75385160	missense	probably damaging	0.97
IGL00161:Ltbp1	APN	17	75310152	splice site	probably benign
IGL00771:Ltbp1	APN	17	75362516	missense	probably damaging	1.00
IGL00822:Ltbp1	APN	17	75151321	missense	probably damaging	1.00
IGL01760:Ltbp1	APN	17	75227150	missense	probably damaging	0.97
IGL01796:Ltbp1	APN	17	75227245	splice site	probably benign
IGL01826:Ltbp1	APN	17	75292840	missense	possibly damaging	0.67
IGL02372:Ltbp1	APN	17	75252406	missense	probably damaging	0.99
IGL02792:Ltbp1	APN	17	75282994	missense	probably damaging	1.00
IGL02862:Ltbp1	APN	17	75390471	missense	probably damaging	1.00
IGL03095:Ltbp1	APN	17	75282418	missense	possibly damaging	0.67
IGL03345:Ltbp1	APN	17	75066159	missense	probably damaging	0.99
IGL03404:Ltbp1	APN	17	75225306	missense	probably damaging	0.97
Hiphop	UTSW	17	75359457	missense	probably damaging	0.99
Pygea	UTSW	17	75327228	nonsense	probably null
Twist	UTSW	17	75310222	missense	probably damaging	0.99
R0010:Ltbp1	UTSW	17	75363391	missense	probably damaging	1.00
R0010:Ltbp1	UTSW	17	75363391	missense	probably damaging	1.00
R0022:Ltbp1	UTSW	17	75364360	missense	probably damaging	1.00
R0022:Ltbp1	UTSW	17	75364360	missense	probably damaging	1.00
R0033:Ltbp1	UTSW	17	75276509	missense	possibly damaging	0.66
R0033:Ltbp1	UTSW	17	75276509	missense	possibly damaging	0.66
R0034:Ltbp1	UTSW	17	75047568	intron	probably benign
R0068:Ltbp1	UTSW	17	75359409	missense	probably damaging	1.00
R0068:Ltbp1	UTSW	17	75359409	missense	probably damaging	1.00
R0467:Ltbp1	UTSW	17	75282429	critical splice donor site	probably null
R0554:Ltbp1	UTSW	17	75225279	missense	probably damaging	0.99
R0584:Ltbp1	UTSW	17	75363472	missense	probably damaging	1.00
R0863:Ltbp1	UTSW	17	75252386	missense	probably damaging	1.00
R0991:Ltbp1	UTSW	17	75225285	missense	possibly damaging	0.75
R1084:Ltbp1	UTSW	17	75359425	nonsense	probably null
R1114:Ltbp1	UTSW	17	75360775	missense	probably benign
R1177:Ltbp1	UTSW	17	75225285	missense	possibly damaging	0.75
R1179:Ltbp1	UTSW	17	75225285	missense	possibly damaging	0.75
R1195:Ltbp1	UTSW	17	75225285	missense	possibly damaging	0.75
R1195:Ltbp1	UTSW	17	75225285	missense	possibly damaging	0.75
R1195:Ltbp1	UTSW	17	75225285	missense	possibly damaging	0.75
R1245:Ltbp1	UTSW	17	75327194	splice site	probably benign
R1246:Ltbp1	UTSW	17	75385161	nonsense	probably null
R1258:Ltbp1	UTSW	17	75225285	missense	possibly damaging	0.75
R1259:Ltbp1	UTSW	17	75225285	missense	possibly damaging	0.75
R1260:Ltbp1	UTSW	17	75225285	missense	possibly damaging	0.75
R1262:Ltbp1	UTSW	17	75225285	missense	possibly damaging	0.75
R1265:Ltbp1	UTSW	17	75225285	missense	possibly damaging	0.75
R1267:Ltbp1	UTSW	17	75225285	missense	possibly damaging	0.75
R1269:Ltbp1	UTSW	17	75225285	missense	possibly damaging	0.75
R1272:Ltbp1	UTSW	17	75225285	missense	possibly damaging	0.75
R1411:Ltbp1	UTSW	17	75225285	missense	possibly damaging	0.75
R1579:Ltbp1	UTSW	17	75252367	missense	probably benign	0.00
R1694:Ltbp1	UTSW	17	75225285	missense	possibly damaging	0.75
R1705:Ltbp1	UTSW	17	75385201	splice site	probably null
R1716:Ltbp1	UTSW	17	75315024	missense	probably benign	0.08
R1815:Ltbp1	UTSW	17	75252380	missense	probably benign	0.00
R1932:Ltbp1	UTSW	17	75313034	missense	probably benign	0.01
R1951:Ltbp1	UTSW	17	75151377	missense	probably benign	0.00
R2044:Ltbp1	UTSW	17	75276432	missense	probably damaging	1.00
R2118:Ltbp1	UTSW	17	75310159	missense	possibly damaging	0.52
R2120:Ltbp1	UTSW	17	75310159	missense	possibly damaging	0.52
R2121:Ltbp1	UTSW	17	75310159	missense	possibly damaging	0.52
R2122:Ltbp1	UTSW	17	75310159	missense	possibly damaging	0.52
R2171:Ltbp1	UTSW	17	75291317	missense	probably damaging	0.99
R2237:Ltbp1	UTSW	17	75310163	missense	probably benign	0.31
R2655:Ltbp1	UTSW	17	75005983	missense	possibly damaging	0.76
R2941:Ltbp1	UTSW	17	75179093	missense	probably damaging	1.00
R3177:Ltbp1	UTSW	17	75276480	missense	possibly damaging	0.65
R3177:Ltbp1	UTSW	17	75359278	splice site	probably null
R3277:Ltbp1	UTSW	17	75276480	missense	possibly damaging	0.65
R3277:Ltbp1	UTSW	17	75359278	splice site	probably null
R3797:Ltbp1	UTSW	17	75362630	missense	probably damaging	1.00
R3861:Ltbp1	UTSW	17	75359338	missense	possibly damaging	0.93
R3897:Ltbp1	UTSW	17	75274016	missense	probably damaging	1.00
R4002:Ltbp1	UTSW	17	75310159	missense	probably benign	0.09
R4057:Ltbp1	UTSW	17	75310194	missense	probably damaging	1.00
R4261:Ltbp1	UTSW	17	75291367	nonsense	probably null
R4375:Ltbp1	UTSW	17	75312997	missense	probably damaging	1.00
R4458:Ltbp1	UTSW	17	75276507	missense	possibly damaging	0.96
R4519:Ltbp1	UTSW	17	75364497	missense	probably benign	0.14
R4529:Ltbp1	UTSW	17	75151360	missense	probably benign	0.21
R4614:Ltbp1	UTSW	17	75289994	intron	probably benign
R4724:Ltbp1	UTSW	17	75313008	missense	probably damaging	0.99
R4756:Ltbp1	UTSW	17	75225204	missense	probably damaging	1.00
R4907:Ltbp1	UTSW	17	75005904	missense	probably benign
R4910:Ltbp1	UTSW	17	75327292	missense	probably damaging	1.00
R4976:Ltbp1	UTSW	17	75321095	critical splice donor site	probably null
R5011:Ltbp1	UTSW	17	75066157	missense	probably damaging	0.99
R5047:Ltbp1	UTSW	17	75292886	splice site	probably benign
R5259:Ltbp1	UTSW	17	75363362	missense	probably benign	0.03
R5438:Ltbp1	UTSW	17	75291326	missense	probably damaging	0.98
R5583:Ltbp1	UTSW	17	75291330	missense	probably benign	0.00
R5757:Ltbp1	UTSW	17	75273949	splice site	probably null
R5950:Ltbp1	UTSW	17	75273870	missense	probably damaging	1.00
R5976:Ltbp1	UTSW	17	75290083	missense	probably damaging	1.00
R6267:Ltbp1	UTSW	17	75005989	missense	possibly damaging	0.70
R6383:Ltbp1	UTSW	17	75359457	missense	probably damaging	0.99
R6400:Ltbp1	UTSW	17	75151402	missense	possibly damaging	0.62
R6861:Ltbp1	UTSW	17	75227192	missense	possibly damaging	0.76
R6880:Ltbp1	UTSW	17	75321049	missense	possibly damaging	0.77
R7168:Ltbp1	UTSW	17	75291366	missense	probably damaging	1.00
R7198:Ltbp1	UTSW	17	75226967	missense	possibly damaging	0.94
R7260:Ltbp1	UTSW	17	75066144	missense	probably benign	0.01
R7262:Ltbp1	UTSW	17	75364368	missense	probably damaging	1.00
R7340:Ltbp1	UTSW	17	75327228	nonsense	probably null
R7443:Ltbp1	UTSW	17	75364437	missense	probably damaging	1.00
R7510:Ltbp1	UTSW	17	75352717	missense	probably damaging	1.00
R7717:Ltbp1	UTSW	17	75290078	missense	possibly damaging	0.90
R7720:Ltbp1	UTSW	17	75385124	missense	probably damaging	1.00
R7799:Ltbp1	UTSW	17	75252356	missense	probably damaging	0.99
R7944:Ltbp1	UTSW	17	75390551	makesense	probably null
R7945:Ltbp1	UTSW	17	75390551	makesense	probably null
R7976:Ltbp1	UTSW	17	75363363	missense	possibly damaging	0.94
R8256:Ltbp1	UTSW	17	75315241	intron	probably benign
R8295:Ltbp1	UTSW	17	75179189	missense	probably benign	0.10
R8423:Ltbp1	UTSW	17	75292857	missense	probably benign
R8462:Ltbp1	UTSW	17	75313074	missense	probably damaging	1.00
R8677:Ltbp1	UTSW	17	75348758	missense	probably benign	0.00
R8742:Ltbp1	UTSW	17	75310222	missense	probably damaging	0.99
R8766:Ltbp1	UTSW	17	75296255	nonsense	probably null
R8873:Ltbp1	UTSW	17	75179177	missense	probably damaging	1.00
R8887:Ltbp1	UTSW	17	75179082	missense	probably damaging	1.00
R9100:Ltbp1	UTSW	17	75315107	missense	probably benign	0.10
R9100:Ltbp1	UTSW	17	75315108	missense	probably damaging	0.96
R9141:Ltbp1	UTSW	17	75291314	missense	possibly damaging	0.56
R9204:Ltbp1	UTSW	17	75363430	missense	probably damaging	1.00
R9292:Ltbp1	UTSW	17	75276441	missense	probably damaging	0.99
R9381:Ltbp1	UTSW	17	75389439	missense	probably damaging	1.00
R9423:Ltbp1	UTSW	17	75290117	missense	probably benign
R9426:Ltbp1	UTSW	17	75291314	missense	possibly damaging	0.56
R9448:Ltbp1	UTSW	17	75359460	nonsense	probably null
R9519:Ltbp1	UTSW	17	75385195	missense	probably damaging	1.00
R9523:Ltbp1	UTSW	17	75390503	missense	probably benign	0.29
R9625:Ltbp1	UTSW	17	75179162	missense	probably damaging	1.00
R9671:Ltbp1	UTSW	17	75296222	critical splice acceptor site	probably null
X0001:Ltbp1	UTSW	17	75227178	missense	probably benign	0.26

Predicted Primers

PCR Primer
(F):5'- TGCATTTCTGAAGCACTTAGTG -3'
(R):5'- AGCACTGAACTTGTCCATCC -3'

Sequencing Primer
(F):5'- GCATTTCTGAAGCACTTAGTGATAGG -3'
(R):5'- TGAACTTGTCCATCCCTCAAGAAG -3'

Posted On

2019-11-12