Incidental Mutation 'R7676:Keg1'
ID 592476
Institutional Source Beutler Lab
Gene Symbol Keg1
Ensembl Gene ENSMUSG00000024694
Gene Name kidney expressed gene 1
Synonyms 0610008P16Rik, GS4059
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock # R7676 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 12695786-12719902 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 12716045 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glycine at position 154 (V154G)
Ref Sequence ENSEMBL: ENSMUSP00000025598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025598] [ENSMUST00000138545] [ENSMUST00000154822]
AlphaFold Q9DCY0
Predicted Effect probably benign
Transcript: ENSMUST00000025598
AA Change: V154G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000025598
Gene: ENSMUSG00000024694
AA Change: V154G

DomainStartEndE-ValueType
Pfam:Gly_acyl_tr_N 1 205 1.2e-89 PFAM
Pfam:Gly_acyl_tr_C 206 294 1.9e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138545
AA Change: V144G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000116555
Gene: ENSMUSG00000024694
AA Change: V144G

DomainStartEndE-ValueType
Pfam:Gly_acyl_tr_N 1 195 4.2e-96 PFAM
Pfam:Gly_acyl_tr_C 196 228 4.3e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154822
AA Change: V144G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000119879
Gene: ENSMUSG00000024694
AA Change: V144G

DomainStartEndE-ValueType
Pfam:Gly_acyl_tr_N 1 156 1.2e-71 PFAM
Pfam:Gly_acyl_tr_C 153 221 3.2e-37 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca A G 11: 84,294,987 D116G possibly damaging Het
Adam6a G A 12: 113,544,576 G190S probably benign Het
Adnp G A 2: 168,183,447 R643* probably null Het
Akap6 A G 12: 52,886,850 D375G possibly damaging Het
Aldh1l2 G T 10: 83,508,111 A480E probably benign Het
Ccdc175 T A 12: 72,102,047 Q779L possibly damaging Het
D430042O09Rik A G 7: 125,850,377 D897G probably benign Het
Dnah7b T G 1: 46,234,164 L2484* probably null Het
Dnajc21 T C 15: 10,462,344 Y65C possibly damaging Het
Dnhd1 C A 7: 105,684,087 N255K probably benign Het
Efhc1 G T 1: 20,967,369 G257W probably damaging Het
Fars2 C A 13: 36,205,043 L172I probably benign Het
Fat4 T C 3: 38,891,697 Y1580H probably damaging Het
Fli1 T A 9: 32,428,030 N253Y probably benign Het
Foxd3 G T 4: 99,656,914 C97F probably damaging Het
Gem C A 4: 11,711,170 D120E possibly damaging Het
Ighv10-3 A G 12: 114,523,679 C41R probably damaging Het
Kcnab3 A G 11: 69,326,727 S16G probably benign Het
Lrrc45 G A 11: 120,720,322 R602H probably damaging Het
Ltbp1 A G 17: 75,291,297 D591G possibly damaging Het
Mmp10 T A 9: 7,503,549 V140D probably damaging Het
Nat8f2 A T 6: 85,868,212 M56K probably benign Het
Nckipsd T C 9: 108,814,954 F525L probably damaging Het
Olfr1328 A G 4: 118,934,150 S233P probably damaging Het
Olfr1406 T A 1: 173,183,553 K294* probably null Het
Olfr804 G T 10: 129,705,286 S136I possibly damaging Het
P2ry12 T A 3: 59,217,757 M166L possibly damaging Het
Palm3 T C 8: 84,029,445 S529P possibly damaging Het
Pdilt A T 7: 119,494,997 Y344N probably damaging Het
Pip4k2b A T 11: 97,720,362 N309K probably benign Het
Pkd1l1 C T 11: 8,962,708 V166I Het
Plxdc2 C T 2: 16,712,083 S377L probably benign Het
Rc3h2 A T 2: 37,405,332 V224E possibly damaging Het
Stk32c T A 7: 139,105,304 D428V possibly damaging Het
Ttn T C 2: 76,814,607 D12968G probably damaging Het
Tulp2 G T 7: 45,521,027 V457F possibly damaging Het
Vcan A T 13: 89,691,789 S1879T probably damaging Het
Vmn1r51 T C 6: 90,129,455 Y118H probably benign Het
Zfat A C 15: 68,224,844 V40G possibly damaging Het
Other mutations in Keg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01071:Keg1 APN 19 12719000 missense probably damaging 1.00
IGL01084:Keg1 APN 19 12714612 missense probably damaging 1.00
IGL02563:Keg1 APN 19 12719157 missense probably damaging 1.00
IGL03328:Keg1 APN 19 12719097 missense probably damaging 1.00
R0103:Keg1 UTSW 19 12718916 missense possibly damaging 0.79
R0103:Keg1 UTSW 19 12718916 missense possibly damaging 0.79
R0417:Keg1 UTSW 19 12711060 missense probably damaging 1.00
R1300:Keg1 UTSW 19 12719004 missense probably damaging 0.98
R1476:Keg1 UTSW 19 12716023 missense probably benign
R1482:Keg1 UTSW 19 12718821 missense probably damaging 1.00
R1643:Keg1 UTSW 19 12719042 missense probably benign 0.00
R4002:Keg1 UTSW 19 12718943 missense possibly damaging 0.95
R5022:Keg1 UTSW 19 12719157 missense probably damaging 1.00
R5164:Keg1 UTSW 19 12714680 intron probably benign
R5386:Keg1 UTSW 19 12714538 missense probably damaging 1.00
R6289:Keg1 UTSW 19 12714573 missense probably damaging 0.98
R6517:Keg1 UTSW 19 12715910 missense probably benign 0.00
R6656:Keg1 UTSW 19 12709630 nonsense probably null
R7117:Keg1 UTSW 19 12709678 missense probably damaging 1.00
R7807:Keg1 UTSW 19 12714634 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CCTGTCATGATGTAACACAAGACT -3'
(R):5'- CATTTGTATGGGTGTGACTTTCTCC -3'

Sequencing Primer
(F):5'- AGACTTGATTCTAAGCTCATATTCCC -3'
(R):5'- CCAGTTCAGAAGGGACTCTATGCTG -3'
Posted On 2019-11-12