Incidental Mutation 'R7676:Keg1'
ID 592476
Institutional Source Beutler Lab
Gene Symbol Keg1
Ensembl Gene ENSMUSG00000024694
Gene Name kidney expressed gene 1
Synonyms 0610008P16Rik, GS4059
MMRRC Submission 045647-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.082) question?
Stock # R7676 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 12673154-12697266 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 12693409 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glycine at position 154 (V154G)
Ref Sequence ENSEMBL: ENSMUSP00000025598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025598] [ENSMUST00000138545] [ENSMUST00000154822]
AlphaFold Q9DCY0
Predicted Effect probably benign
Transcript: ENSMUST00000025598
AA Change: V154G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000025598
Gene: ENSMUSG00000024694
AA Change: V154G

DomainStartEndE-ValueType
Pfam:Gly_acyl_tr_N 1 205 1.2e-89 PFAM
Pfam:Gly_acyl_tr_C 206 294 1.9e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138545
AA Change: V144G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000116555
Gene: ENSMUSG00000024694
AA Change: V144G

DomainStartEndE-ValueType
Pfam:Gly_acyl_tr_N 1 195 4.2e-96 PFAM
Pfam:Gly_acyl_tr_C 196 228 4.3e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154822
AA Change: V144G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000119879
Gene: ENSMUSG00000024694
AA Change: V144G

DomainStartEndE-ValueType
Pfam:Gly_acyl_tr_N 1 156 1.2e-71 PFAM
Pfam:Gly_acyl_tr_C 153 221 3.2e-37 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca A G 11: 84,185,813 (GRCm39) D116G possibly damaging Het
Adam6a G A 12: 113,508,196 (GRCm39) G190S probably benign Het
Adnp G A 2: 168,025,367 (GRCm39) R643* probably null Het
Akap6 A G 12: 52,933,633 (GRCm39) D375G possibly damaging Het
Aldh1l2 G T 10: 83,343,975 (GRCm39) A480E probably benign Het
Ccdc175 T A 12: 72,148,821 (GRCm39) Q779L possibly damaging Het
Dnah7b T G 1: 46,273,324 (GRCm39) L2484* probably null Het
Dnajc21 T C 15: 10,462,430 (GRCm39) Y65C possibly damaging Het
Dnhd1 C A 7: 105,333,294 (GRCm39) N255K probably benign Het
Efhc1 G T 1: 21,037,593 (GRCm39) G257W probably damaging Het
Fars2 C A 13: 36,389,026 (GRCm39) L172I probably benign Het
Fat4 T C 3: 38,945,846 (GRCm39) Y1580H probably damaging Het
Fli1 T A 9: 32,339,326 (GRCm39) N253Y probably benign Het
Foxd3 G T 4: 99,545,151 (GRCm39) C97F probably damaging Het
Gem C A 4: 11,711,170 (GRCm39) D120E possibly damaging Het
Ighv10-3 A G 12: 114,487,299 (GRCm39) C41R probably damaging Het
Katnip A G 7: 125,449,549 (GRCm39) D897G probably benign Het
Kcnab3 A G 11: 69,217,553 (GRCm39) S16G probably benign Het
Lrrc45 G A 11: 120,611,148 (GRCm39) R602H probably damaging Het
Ltbp1 A G 17: 75,598,292 (GRCm39) D591G possibly damaging Het
Mmp10 T A 9: 7,503,550 (GRCm39) V140D probably damaging Het
Nat8f2 A T 6: 85,845,194 (GRCm39) M56K probably benign Het
Nckipsd T C 9: 108,692,153 (GRCm39) F525L probably damaging Het
Or10ak7 A G 4: 118,791,347 (GRCm39) S233P probably damaging Het
Or10j7 T A 1: 173,011,120 (GRCm39) K294* probably null Het
Or6c6c G T 10: 129,541,155 (GRCm39) S136I possibly damaging Het
P2ry12 T A 3: 59,125,178 (GRCm39) M166L possibly damaging Het
Palm3 T C 8: 84,756,074 (GRCm39) S529P possibly damaging Het
Pdilt A T 7: 119,094,220 (GRCm39) Y344N probably damaging Het
Pip4k2b A T 11: 97,611,188 (GRCm39) N309K probably benign Het
Pkd1l1 C T 11: 8,912,708 (GRCm39) V166I Het
Plxdc2 C T 2: 16,716,894 (GRCm39) S377L probably benign Het
Rc3h2 A T 2: 37,295,344 (GRCm39) V224E possibly damaging Het
Stk32c T A 7: 138,685,220 (GRCm39) D428V possibly damaging Het
Ttn T C 2: 76,644,951 (GRCm39) D12968G probably damaging Het
Tulp2 G T 7: 45,170,451 (GRCm39) V457F possibly damaging Het
Vcan A T 13: 89,839,908 (GRCm39) S1879T probably damaging Het
Vmn1r51 T C 6: 90,106,437 (GRCm39) Y118H probably benign Het
Zfat A C 15: 68,096,693 (GRCm39) V40G possibly damaging Het
Other mutations in Keg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01071:Keg1 APN 19 12,696,364 (GRCm39) missense probably damaging 1.00
IGL01084:Keg1 APN 19 12,691,976 (GRCm39) missense probably damaging 1.00
IGL02563:Keg1 APN 19 12,696,521 (GRCm39) missense probably damaging 1.00
IGL03328:Keg1 APN 19 12,696,461 (GRCm39) missense probably damaging 1.00
R0103:Keg1 UTSW 19 12,696,280 (GRCm39) missense possibly damaging 0.79
R0103:Keg1 UTSW 19 12,696,280 (GRCm39) missense possibly damaging 0.79
R0417:Keg1 UTSW 19 12,688,424 (GRCm39) missense probably damaging 1.00
R1300:Keg1 UTSW 19 12,696,368 (GRCm39) missense probably damaging 0.98
R1476:Keg1 UTSW 19 12,693,387 (GRCm39) missense probably benign
R1482:Keg1 UTSW 19 12,696,185 (GRCm39) missense probably damaging 1.00
R1643:Keg1 UTSW 19 12,696,406 (GRCm39) missense probably benign 0.00
R4002:Keg1 UTSW 19 12,696,307 (GRCm39) missense possibly damaging 0.95
R5022:Keg1 UTSW 19 12,696,521 (GRCm39) missense probably damaging 1.00
R5164:Keg1 UTSW 19 12,692,044 (GRCm39) intron probably benign
R5386:Keg1 UTSW 19 12,691,902 (GRCm39) missense probably damaging 1.00
R6289:Keg1 UTSW 19 12,691,937 (GRCm39) missense probably damaging 0.98
R6517:Keg1 UTSW 19 12,693,274 (GRCm39) missense probably benign 0.00
R6656:Keg1 UTSW 19 12,686,994 (GRCm39) nonsense probably null
R7117:Keg1 UTSW 19 12,687,042 (GRCm39) missense probably damaging 1.00
R7807:Keg1 UTSW 19 12,691,998 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CCTGTCATGATGTAACACAAGACT -3'
(R):5'- CATTTGTATGGGTGTGACTTTCTCC -3'

Sequencing Primer
(F):5'- AGACTTGATTCTAAGCTCATATTCCC -3'
(R):5'- CCAGTTCAGAAGGGACTCTATGCTG -3'
Posted On 2019-11-12