Incidental Mutation 'R7677:Hoxd13'
ID592486
Institutional Source Beutler Lab
Gene Symbol Hoxd13
Ensembl Gene ENSMUSG00000001819
Gene Namehomeobox D13
SynonymsHox-4.8, spdh
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.661) question?
Stock #R7677 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location74668310-74671599 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 74668565 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 86 (S86P)
Ref Sequence ENSEMBL: ENSMUSP00000001872 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001872]
Predicted Effect probably benign
Transcript: ENSMUST00000001872
AA Change: S86P

PolyPhen 2 Score 0.389 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000001872
Gene: ENSMUSG00000001819
AA Change: S86P

DomainStartEndE-ValueType
low complexity region 14 34 N/A INTRINSIC
Pfam:HoxA13_N 75 177 4e-18 PFAM
HOX 272 334 4.33e-22 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the homeobox family of genes. The homeobox genes encode a highly conserved family of transcription factors that play an important role in morphogenesis in all multicellular organisms. Mammals possess four similar homeobox gene clusters, HOXA, HOXB, HOXC and HOXD, located on different chromosomes, consisting of 9 to 11 genes arranged in tandem. This gene is one of several homeobox HOXD genes located in a cluster on chromosome 2. Deletions that remove the entire HOXD gene cluster or the 5' end of this cluster have been associated with severe limb and genital abnormalities. Mutations in this particular gene cause synpolydactyly. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted and spontaneous mutations exhibit abnormalities of the axial skeleton, especially limbs, and of the male accessory organs, and agenesis of the preputial glands. Mutant males are sterile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,298,349 R2699* probably null Het
Adra2a G A 19: 54,046,944 V244M probably damaging Het
Apba2 A G 7: 64,695,097 S12G probably benign Het
Arhgap20 T A 9: 51,840,398 M383K probably damaging Het
Armc12 T C 17: 28,537,891 V210A probably benign Het
Ash1l A T 3: 89,043,193 H2131L probably damaging Het
Atg5 T C 10: 44,347,039 L219P probably damaging Het
Atp2c2 A T 8: 119,748,176 M507L probably benign Het
Atr T A 9: 95,885,462 L1191I probably damaging Het
B4galt5 T C 2: 167,305,078 T279A probably damaging Het
Bglap2 T C 3: 88,377,973 E62G probably damaging Het
Card6 A G 15: 5,098,444 S1157P unknown Het
Ccdc17 T C 4: 116,597,765 probably null Het
Cdc6 T A 11: 98,919,365 L500* probably null Het
Dst G T 1: 34,169,322 probably null Het
Fbxw7 C T 3: 84,904,066 T166I Het
Fer1l6 T C 15: 58,602,290 V955A probably benign Het
Fezf2 T C 14: 12,344,941 E82G probably benign Het
Flii T C 11: 60,720,145 D486G probably damaging Het
Fndc3a T C 14: 72,567,414 T476A probably benign Het
Gbp3 C T 3: 142,560,503 probably benign Het
Gm9268 A C 7: 43,024,739 H414P probably damaging Het
Hebp2 T C 10: 18,545,799 probably benign Het
Hhipl2 T A 1: 183,424,043 M88K possibly damaging Het
Hip1 A G 5: 135,430,317 C605R probably benign Het
Hspa12a G T 19: 58,860,885 A2E probably benign Het
Il1rl1 A C 1: 40,446,704 *338C probably null Het
Lrrc37a G T 11: 103,499,638 P1654T probably benign Het
Mybpc3 A T 2: 91,129,031 D704V probably benign Het
Napsa A T 7: 44,581,706 K120* probably null Het
Nat3 A C 8: 67,547,487 Y6S probably damaging Het
Negr1 C T 3: 157,069,186 Q180* probably null Het
Nynrin T A 14: 55,870,236 D933E probably benign Het
Olfr119 T A 17: 37,701,066 I132K probably damaging Het
Olfr1413 C T 1: 92,573,261 T30I not run Het
Olfr167 G A 16: 19,514,928 A236V probably benign Het
Olfr420 A T 1: 174,159,048 I92F probably damaging Het
Olfr894 T A 9: 38,219,028 N65K probably damaging Het
Olfr905 T A 9: 38,473,535 S263T possibly damaging Het
Olfr95 A T 17: 37,211,495 Y119* probably null Het
Pbx1 A T 1: 168,203,426 F208I probably damaging Het
Pcdha11 T C 18: 37,011,552 V232A probably damaging Het
Pcsk5 A G 19: 17,581,229 Y605H possibly damaging Het
Pde3a T A 6: 141,250,257 L223Q probably damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Pitpnm2 G A 5: 124,123,569 R977C probably damaging Het
Pkdrej A C 15: 85,815,587 D2049E probably benign Het
Psmd6 T C 14: 14,120,837 D16G probably benign Het
Pth2r C A 1: 65,388,446 T426N probably benign Het
Ralgapa1 G T 12: 55,659,143 L1865M probably damaging Het
Ryr3 T A 2: 112,833,900 Q1702L probably benign Het
Sars2 A G 7: 28,746,751 Y135C probably benign Het
Sdha G A 13: 74,333,053 R345* probably null Het
Selp A T 1: 164,133,956 S413C probably damaging Het
Sirt2 G A 7: 28,785,410 C221Y probably damaging Het
Skiv2l A T 17: 34,848,164 S100T probably benign Het
Socs7 C A 11: 97,389,642 Q566K probably benign Het
Spdye4c G A 2: 128,594,136 V151M probably benign Het
Srcap A G 7: 127,559,808 D2952G unknown Het
Srd5a2 A T 17: 74,047,754 L25Q probably damaging Het
Srrt A T 5: 137,300,148 V254D probably damaging Het
Tap2 T C 17: 34,205,520 F76L probably benign Het
Tdpoz4 T A 3: 93,797,508 *371R probably null Het
Tm9sf3 A T 19: 41,221,304 F441I probably damaging Het
Tmem259 C T 10: 79,978,580 R314Q probably damaging Het
Trim28 G T 7: 13,028,113 R312L possibly damaging Het
Tsc1 A G 2: 28,672,817 T393A probably benign Het
Txndc11 CCCGCCGCCGCCGCCGC CCCGCCGCCGCCGC 16: 11,134,474 probably benign Het
Ube2v2 T C 16: 15,581,100 T42A probably benign Het
Zfp609 A T 9: 65,697,174 S1342R possibly damaging Het
Zg16 A T 7: 127,050,591 V66E probably damaging Het
Other mutations in Hoxd13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03108:Hoxd13 APN 2 74670096 missense probably damaging 1.00
R1722:Hoxd13 UTSW 2 74670045 missense probably benign 0.34
R2163:Hoxd13 UTSW 2 74669069 missense possibly damaging 0.82
R4116:Hoxd13 UTSW 2 74668488 missense possibly damaging 0.93
R4400:Hoxd13 UTSW 2 74670015 missense probably damaging 1.00
R4424:Hoxd13 UTSW 2 74669957 nonsense probably null
R4938:Hoxd13 UTSW 2 74668683 missense probably benign 0.26
R5535:Hoxd13 UTSW 2 74668797 missense probably damaging 0.99
R7054:Hoxd13 UTSW 2 74669025 missense probably damaging 1.00
R7069:Hoxd13 UTSW 2 74669024 missense probably damaging 1.00
R8329:Hoxd13 UTSW 2 74668317 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TATAAACGTCCCGCGATGAG -3'
(R):5'- TTCTGCTGTAAGCCTACGC -3'

Sequencing Primer
(F):5'- CGCGATGAGCTAACCTGTTG -3'
(R):5'- TGTAAGCCTACGCCGTGC -3'
Posted On2019-11-12