Incidental Mutation 'R7677:Atp2c2'
ID 592512
Institutional Source Beutler Lab
Gene Symbol Atp2c2
Ensembl Gene ENSMUSG00000034112
Gene Name ATPase, Ca++ transporting, type 2C, member 2
Synonyms 1810010G06Rik
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7677 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 120426748-120484456 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 120474915 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 507 (M507L)
Ref Sequence ENSEMBL: ENSMUSP00000092794 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095171]
AlphaFold A7L9Z8
Predicted Effect probably benign
Transcript: ENSMUST00000095171
AA Change: M507L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000092794
Gene: ENSMUSG00000034112
AA Change: M507L

DomainStartEndE-ValueType
Cation_ATPase_N 54 128 1.27e-12 SMART
Pfam:E1-E2_ATPase 133 366 1.7e-62 PFAM
Pfam:Hydrolase 371 684 5.3e-18 PFAM
Pfam:HAD 374 681 7.4e-11 PFAM
Pfam:Cation_ATPase 437 521 1.1e-17 PFAM
Pfam:Cation_ATPase_C 754 927 1.1e-47 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,248,349 (GRCm39) R2699* probably null Het
Adra2a G A 19: 54,035,375 (GRCm39) V244M probably damaging Het
Apba2 A G 7: 64,344,845 (GRCm39) S12G probably benign Het
Arhgap20 T A 9: 51,751,698 (GRCm39) M383K probably damaging Het
Armc12 T C 17: 28,756,865 (GRCm39) V210A probably benign Het
Ash1l A T 3: 88,950,500 (GRCm39) H2131L probably damaging Het
Atg5 T C 10: 44,223,035 (GRCm39) L219P probably damaging Het
Atr T A 9: 95,767,515 (GRCm39) L1191I probably damaging Het
B4galt5 T C 2: 167,146,998 (GRCm39) T279A probably damaging Het
Bglap2 T C 3: 88,285,280 (GRCm39) E62G probably damaging Het
Card6 A G 15: 5,127,926 (GRCm39) S1157P unknown Het
Ccdc17 T C 4: 116,454,962 (GRCm39) probably null Het
Cdc6 T A 11: 98,810,191 (GRCm39) L500* probably null Het
Dst G T 1: 34,208,403 (GRCm39) probably null Het
Fbxw7 C T 3: 84,811,373 (GRCm39) T166I Het
Fer1l6 T C 15: 58,474,139 (GRCm39) V955A probably benign Het
Fezf2 T C 14: 12,344,941 (GRCm38) E82G probably benign Het
Flii T C 11: 60,610,971 (GRCm39) D486G probably damaging Het
Fndc3a T C 14: 72,804,854 (GRCm39) T476A probably benign Het
Gbp3 C T 3: 142,266,264 (GRCm39) probably benign Het
Hebp2 T C 10: 18,421,547 (GRCm39) probably benign Het
Hhipl2 T A 1: 183,204,951 (GRCm39) M88K possibly damaging Het
Hip1 A G 5: 135,459,171 (GRCm39) C605R probably benign Het
Hoxd13 T C 2: 74,498,909 (GRCm39) S86P probably benign Het
Hspa12a G T 19: 58,849,317 (GRCm39) A2E probably benign Het
Il1rl1 A C 1: 40,485,864 (GRCm39) *338C probably null Het
Lrrc37a G T 11: 103,390,464 (GRCm39) P1654T probably benign Het
Mybpc3 A T 2: 90,959,376 (GRCm39) D704V probably benign Het
Napsa A T 7: 44,231,130 (GRCm39) K120* probably null Het
Nat3 A C 8: 68,000,139 (GRCm39) Y6S probably damaging Het
Negr1 C T 3: 156,774,823 (GRCm39) Q180* probably null Het
Nynrin T A 14: 56,107,693 (GRCm39) D933E probably benign Het
Or10al3 T A 17: 38,011,957 (GRCm39) I132K probably damaging Het
Or10c1 A T 17: 37,522,386 (GRCm39) Y119* probably null Het
Or2l5 G A 16: 19,333,678 (GRCm39) A236V probably benign Het
Or6k2 A T 1: 173,986,614 (GRCm39) I92F probably damaging Het
Or8b1c T A 9: 38,384,831 (GRCm39) S263T possibly damaging Het
Or8c16 T A 9: 38,130,324 (GRCm39) N65K probably damaging Het
Or9s23 C T 1: 92,500,983 (GRCm39) T30I not run Het
Pbx1 A T 1: 168,030,995 (GRCm39) F208I probably damaging Het
Pcdha11 T C 18: 37,144,605 (GRCm39) V232A probably damaging Het
Pcsk5 A G 19: 17,558,593 (GRCm39) Y605H possibly damaging Het
Pde3a T A 6: 141,195,983 (GRCm39) L223Q probably damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 (GRCm39) probably benign Het
Pitpnm2 G A 5: 124,261,632 (GRCm39) R977C probably damaging Het
Pkdrej A C 15: 85,699,788 (GRCm39) D2049E probably benign Het
Psmd6 T C 14: 14,120,837 (GRCm38) D16G probably benign Het
Pth2r C A 1: 65,427,605 (GRCm39) T426N probably benign Het
Ralgapa1 G T 12: 55,705,928 (GRCm39) L1865M probably damaging Het
Ryr3 T A 2: 112,664,245 (GRCm39) Q1702L probably benign Het
Sars2 A G 7: 28,446,176 (GRCm39) Y135C probably benign Het
Sdha G A 13: 74,481,172 (GRCm39) R345* probably null Het
Selp A T 1: 163,961,525 (GRCm39) S413C probably damaging Het
Sirt2 G A 7: 28,484,835 (GRCm39) C221Y probably damaging Het
Skic2 A T 17: 35,067,140 (GRCm39) S100T probably benign Het
Socs7 C A 11: 97,280,468 (GRCm39) Q566K probably benign Het
Spdye4c G A 2: 128,436,056 (GRCm39) V151M probably benign Het
Srcap A G 7: 127,158,980 (GRCm39) D2952G unknown Het
Srd5a2 A T 17: 74,354,749 (GRCm39) L25Q probably damaging Het
Srrt A T 5: 137,298,410 (GRCm39) V254D probably damaging Het
Tap2 T C 17: 34,424,494 (GRCm39) F76L probably benign Het
Tdpoz4 T A 3: 93,704,815 (GRCm39) *371R probably null Het
Tm9sf3 A T 19: 41,209,743 (GRCm39) F441I probably damaging Het
Tmem259 C T 10: 79,814,414 (GRCm39) R314Q probably damaging Het
Trim28 G T 7: 12,762,040 (GRCm39) R312L possibly damaging Het
Tsc1 A G 2: 28,562,829 (GRCm39) T393A probably benign Het
Txndc11 CCCGCCGCCGCCGCCGC CCCGCCGCCGCCGC 16: 10,952,338 (GRCm39) probably benign Het
Ube2v2 T C 16: 15,398,964 (GRCm39) T42A probably benign Het
Vmn2r-ps158 A C 7: 42,674,163 (GRCm39) H414P probably damaging Het
Zfp609 A T 9: 65,604,456 (GRCm39) S1342R possibly damaging Het
Zg16 A T 7: 126,649,763 (GRCm39) V66E probably damaging Het
Other mutations in Atp2c2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00966:Atp2c2 APN 8 120,472,329 (GRCm39) missense probably benign
IGL01624:Atp2c2 APN 8 120,484,189 (GRCm39) missense probably benign 0.00
IGL02133:Atp2c2 APN 8 120,481,074 (GRCm39) missense probably benign 0.00
IGL02221:Atp2c2 APN 8 120,471,073 (GRCm39) missense probably damaging 1.00
IGL02606:Atp2c2 APN 8 120,457,013 (GRCm39) missense probably benign
IGL02657:Atp2c2 APN 8 120,479,771 (GRCm39) missense probably damaging 1.00
IGL02839:Atp2c2 APN 8 120,475,859 (GRCm39) missense possibly damaging 0.85
IGL03122:Atp2c2 APN 8 120,469,414 (GRCm39) missense possibly damaging 0.77
R0031:Atp2c2 UTSW 8 120,475,801 (GRCm39) missense probably benign 0.15
R0372:Atp2c2 UTSW 8 120,484,180 (GRCm39) missense probably benign
R0502:Atp2c2 UTSW 8 120,461,316 (GRCm39) missense probably null 0.99
R0503:Atp2c2 UTSW 8 120,461,316 (GRCm39) missense probably null 0.99
R0584:Atp2c2 UTSW 8 120,465,157 (GRCm39) missense probably benign 0.01
R1225:Atp2c2 UTSW 8 120,461,984 (GRCm39) missense probably damaging 1.00
R1580:Atp2c2 UTSW 8 120,479,726 (GRCm39) missense probably benign 0.00
R1620:Atp2c2 UTSW 8 120,475,865 (GRCm39) missense probably benign
R1638:Atp2c2 UTSW 8 120,482,742 (GRCm39) missense possibly damaging 0.82
R1745:Atp2c2 UTSW 8 120,451,833 (GRCm39) missense probably benign 0.02
R1746:Atp2c2 UTSW 8 120,461,182 (GRCm39) unclassified probably benign
R1907:Atp2c2 UTSW 8 120,476,615 (GRCm39) splice site probably benign
R2104:Atp2c2 UTSW 8 120,476,584 (GRCm39) missense probably benign
R2151:Atp2c2 UTSW 8 120,482,841 (GRCm39) missense probably benign
R2152:Atp2c2 UTSW 8 120,482,841 (GRCm39) missense probably benign
R2154:Atp2c2 UTSW 8 120,482,841 (GRCm39) missense probably benign
R2207:Atp2c2 UTSW 8 120,475,048 (GRCm39) missense probably damaging 1.00
R3874:Atp2c2 UTSW 8 120,462,035 (GRCm39) missense possibly damaging 0.74
R3912:Atp2c2 UTSW 8 120,448,015 (GRCm39) missense probably damaging 1.00
R4093:Atp2c2 UTSW 8 120,476,610 (GRCm39) critical splice donor site probably null
R4782:Atp2c2 UTSW 8 120,475,891 (GRCm39) missense probably damaging 0.97
R4801:Atp2c2 UTSW 8 120,474,426 (GRCm39) missense probably damaging 1.00
R4973:Atp2c2 UTSW 8 120,481,002 (GRCm39) missense probably benign 0.00
R5485:Atp2c2 UTSW 8 120,479,801 (GRCm39) critical splice donor site probably null
R5978:Atp2c2 UTSW 8 120,476,614 (GRCm39) splice site probably null
R6377:Atp2c2 UTSW 8 120,453,093 (GRCm39) missense probably benign 0.10
R6613:Atp2c2 UTSW 8 120,482,760 (GRCm39) missense probably damaging 0.99
R6765:Atp2c2 UTSW 8 120,479,756 (GRCm39) missense probably damaging 1.00
R6836:Atp2c2 UTSW 8 120,461,154 (GRCm39) missense probably damaging 1.00
R6963:Atp2c2 UTSW 8 120,457,006 (GRCm39) nonsense probably null
R7220:Atp2c2 UTSW 8 120,472,300 (GRCm39) missense probably benign 0.00
R7238:Atp2c2 UTSW 8 120,469,160 (GRCm39) missense possibly damaging 0.73
R7373:Atp2c2 UTSW 8 120,456,991 (GRCm39) missense probably benign 0.02
R7438:Atp2c2 UTSW 8 120,474,936 (GRCm39) missense probably damaging 1.00
R7573:Atp2c2 UTSW 8 120,478,008 (GRCm39) missense probably damaging 1.00
R7737:Atp2c2 UTSW 8 120,469,134 (GRCm39) missense probably damaging 1.00
R7912:Atp2c2 UTSW 8 120,456,917 (GRCm39) missense possibly damaging 0.81
R8821:Atp2c2 UTSW 8 120,476,033 (GRCm39) splice site probably null
R8831:Atp2c2 UTSW 8 120,476,033 (GRCm39) splice site probably null
R9200:Atp2c2 UTSW 8 120,474,999 (GRCm39) nonsense probably null
R9211:Atp2c2 UTSW 8 120,446,032 (GRCm39) missense probably benign
R9246:Atp2c2 UTSW 8 120,456,989 (GRCm39) missense probably damaging 1.00
R9285:Atp2c2 UTSW 8 120,465,141 (GRCm39) missense probably benign 0.00
RF004:Atp2c2 UTSW 8 120,479,561 (GRCm39) missense probably damaging 1.00
RF012:Atp2c2 UTSW 8 120,472,253 (GRCm39) missense possibly damaging 0.91
Z1177:Atp2c2 UTSW 8 120,461,124 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTCCTAGCCTGCATTGTAAAGTC -3'
(R):5'- GTCCATCCTGACTGTGAAGG -3'

Sequencing Primer
(F):5'- CATTGTAAAGTCCAGGTGTAGACCC -3'
(R):5'- AAGGTTCACACTGGGCCTTG -3'
Posted On 2019-11-12