Incidental Mutation 'R7677:Ralgapa1'
ID592526
Institutional Source Beutler Lab
Gene Symbol Ralgapa1
Ensembl Gene ENSMUSG00000021027
Gene NameRal GTPase activating protein, alpha subunit 1
SynonymsGarnl1, 4930400K19Rik, 2310003F20Rik, Tulip1
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.810) question?
Stock #R7677 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location55602896-55821167 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 55659143 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Methionine at position 1865 (L1865M)
Ref Sequence ENSEMBL: ENSMUSP00000082503 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085385] [ENSMUST00000110687] [ENSMUST00000219432] [ENSMUST00000220367] [ENSMUST00000226244]
Predicted Effect probably damaging
Transcript: ENSMUST00000085385
AA Change: L1865M

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000082503
Gene: ENSMUSG00000021027
AA Change: L1865M

DomainStartEndE-ValueType
low complexity region 644 651 N/A INTRINSIC
low complexity region 676 690 N/A INTRINSIC
low complexity region 692 704 N/A INTRINSIC
low complexity region 894 915 N/A INTRINSIC
low complexity region 1386 1395 N/A INTRINSIC
low complexity region 1784 1798 N/A INTRINSIC
Pfam:Rap_GAP 1824 2003 7.4e-66 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110687
AA Change: L1865M

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000106315
Gene: ENSMUSG00000021027
AA Change: L1865M

DomainStartEndE-ValueType
low complexity region 644 651 N/A INTRINSIC
low complexity region 676 690 N/A INTRINSIC
low complexity region 692 704 N/A INTRINSIC
low complexity region 894 915 N/A INTRINSIC
low complexity region 1386 1395 N/A INTRINSIC
low complexity region 1784 1798 N/A INTRINSIC
Pfam:Rap_GAP 1824 2001 1.9e-48 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000219432
AA Change: L1912M

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect possibly damaging
Transcript: ENSMUST00000220367
AA Change: L1865M

PolyPhen 2 Score 0.920 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000226244
AA Change: L2321M

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a major subunit of the RAL-GTPase activating protein. A similar protein in mouse binds E12, a transcriptional regulator of immunoglobulin genes. The mouse protein also functions in skeletal muscle by binding to the regulatory 14-3-3 proteins upon stimulation with insulin or muscle contraction. A pseudogene of this gene has been identified on chromosome 9. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,298,349 R2699* probably null Het
Adra2a G A 19: 54,046,944 V244M probably damaging Het
Apba2 A G 7: 64,695,097 S12G probably benign Het
Arhgap20 T A 9: 51,840,398 M383K probably damaging Het
Armc12 T C 17: 28,537,891 V210A probably benign Het
Ash1l A T 3: 89,043,193 H2131L probably damaging Het
Atg5 T C 10: 44,347,039 L219P probably damaging Het
Atp2c2 A T 8: 119,748,176 M507L probably benign Het
Atr T A 9: 95,885,462 L1191I probably damaging Het
B4galt5 T C 2: 167,305,078 T279A probably damaging Het
Bglap2 T C 3: 88,377,973 E62G probably damaging Het
Card6 A G 15: 5,098,444 S1157P unknown Het
Ccdc17 T C 4: 116,597,765 probably null Het
Cdc6 T A 11: 98,919,365 L500* probably null Het
Dst G T 1: 34,169,322 probably null Het
Fbxw7 C T 3: 84,904,066 T166I Het
Fer1l6 T C 15: 58,602,290 V955A probably benign Het
Fezf2 T C 14: 12,344,941 E82G probably benign Het
Flii T C 11: 60,720,145 D486G probably damaging Het
Fndc3a T C 14: 72,567,414 T476A probably benign Het
Gbp3 C T 3: 142,560,503 probably benign Het
Gm9268 A C 7: 43,024,739 H414P probably damaging Het
Hebp2 T C 10: 18,545,799 probably benign Het
Hhipl2 T A 1: 183,424,043 M88K possibly damaging Het
Hip1 A G 5: 135,430,317 C605R probably benign Het
Hoxd13 T C 2: 74,668,565 S86P probably benign Het
Hspa12a G T 19: 58,860,885 A2E probably benign Het
Il1rl1 A C 1: 40,446,704 *338C probably null Het
Lrrc37a G T 11: 103,499,638 P1654T probably benign Het
Mybpc3 A T 2: 91,129,031 D704V probably benign Het
Napsa A T 7: 44,581,706 K120* probably null Het
Nat3 A C 8: 67,547,487 Y6S probably damaging Het
Negr1 C T 3: 157,069,186 Q180* probably null Het
Nynrin T A 14: 55,870,236 D933E probably benign Het
Olfr119 T A 17: 37,701,066 I132K probably damaging Het
Olfr1413 C T 1: 92,573,261 T30I not run Het
Olfr167 G A 16: 19,514,928 A236V probably benign Het
Olfr420 A T 1: 174,159,048 I92F probably damaging Het
Olfr894 T A 9: 38,219,028 N65K probably damaging Het
Olfr905 T A 9: 38,473,535 S263T possibly damaging Het
Olfr95 A T 17: 37,211,495 Y119* probably null Het
Pbx1 A T 1: 168,203,426 F208I probably damaging Het
Pcdha11 T C 18: 37,011,552 V232A probably damaging Het
Pcsk5 A G 19: 17,581,229 Y605H possibly damaging Het
Pde3a T A 6: 141,250,257 L223Q probably damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Pitpnm2 G A 5: 124,123,569 R977C probably damaging Het
Pkdrej A C 15: 85,815,587 D2049E probably benign Het
Psmd6 T C 14: 14,120,837 D16G probably benign Het
Pth2r C A 1: 65,388,446 T426N probably benign Het
Ryr3 T A 2: 112,833,900 Q1702L probably benign Het
Sars2 A G 7: 28,746,751 Y135C probably benign Het
Sdha G A 13: 74,333,053 R345* probably null Het
Selp A T 1: 164,133,956 S413C probably damaging Het
Sirt2 G A 7: 28,785,410 C221Y probably damaging Het
Skiv2l A T 17: 34,848,164 S100T probably benign Het
Socs7 C A 11: 97,389,642 Q566K probably benign Het
Spdye4c G A 2: 128,594,136 V151M probably benign Het
Srcap A G 7: 127,559,808 D2952G unknown Het
Srd5a2 A T 17: 74,047,754 L25Q probably damaging Het
Srrt A T 5: 137,300,148 V254D probably damaging Het
Tap2 T C 17: 34,205,520 F76L probably benign Het
Tdpoz4 T A 3: 93,797,508 *371R probably null Het
Tm9sf3 A T 19: 41,221,304 F441I probably damaging Het
Tmem259 C T 10: 79,978,580 R314Q probably damaging Het
Trim28 G T 7: 13,028,113 R312L possibly damaging Het
Tsc1 A G 2: 28,672,817 T393A probably benign Het
Txndc11 CCCGCCGCCGCCGCCGC CCCGCCGCCGCCGC 16: 11,134,474 probably benign Het
Ube2v2 T C 16: 15,581,100 T42A probably benign Het
Zfp609 A T 9: 65,697,174 S1342R possibly damaging Het
Zg16 A T 7: 127,050,591 V66E probably damaging Het
Other mutations in Ralgapa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Ralgapa1 APN 12 55722773 missense probably damaging 0.98
IGL00494:Ralgapa1 APN 12 55747185 missense probably damaging 1.00
IGL00731:Ralgapa1 APN 12 55702452 missense possibly damaging 0.94
IGL00851:Ralgapa1 APN 12 55709575 missense possibly damaging 0.93
IGL01133:Ralgapa1 APN 12 55642348 missense probably damaging 1.00
IGL01133:Ralgapa1 APN 12 55642359 missense probably damaging 0.99
IGL01354:Ralgapa1 APN 12 55777316 missense possibly damaging 0.68
IGL01514:Ralgapa1 APN 12 55719657 missense probably damaging 0.97
IGL02033:Ralgapa1 APN 12 55642477 missense possibly damaging 0.69
IGL02064:Ralgapa1 APN 12 55708077 missense probably damaging 1.00
IGL02556:Ralgapa1 APN 12 55642449 missense possibly damaging 0.80
IGL02605:Ralgapa1 APN 12 55712665 missense possibly damaging 0.90
IGL02657:Ralgapa1 APN 12 55673507 missense probably damaging 1.00
IGL02676:Ralgapa1 APN 12 55676417 missense probably damaging 1.00
IGL02894:Ralgapa1 APN 12 55717069 missense possibly damaging 0.79
IGL02944:Ralgapa1 APN 12 55757951 missense probably benign 0.01
Anhydrous UTSW 12 55795778 critical splice acceptor site probably null
Aqueous UTSW 12 55698854 missense probably damaging 1.00
bantam UTSW 12 55722773 critical splice donor site probably null
Deliquescent UTSW 12 55782900 splice site probably benign
F5770:Ralgapa1 UTSW 12 55795653 splice site probably benign
IGL03046:Ralgapa1 UTSW 12 55695157 missense probably damaging 1.00
R0011:Ralgapa1 UTSW 12 55786263 missense probably damaging 0.99
R0096:Ralgapa1 UTSW 12 55739505 missense probably damaging 1.00
R0277:Ralgapa1 UTSW 12 55677238 missense probably damaging 0.99
R0323:Ralgapa1 UTSW 12 55677238 missense probably damaging 0.99
R0333:Ralgapa1 UTSW 12 55782900 splice site probably benign
R0361:Ralgapa1 UTSW 12 55676569 missense possibly damaging 0.93
R0385:Ralgapa1 UTSW 12 55677038 missense probably damaging 1.00
R0386:Ralgapa1 UTSW 12 55708067 missense probably benign 0.03
R0498:Ralgapa1 UTSW 12 55689791 missense possibly damaging 0.66
R0552:Ralgapa1 UTSW 12 55676765 missense probably benign 0.27
R0564:Ralgapa1 UTSW 12 55782885 missense possibly damaging 0.84
R0611:Ralgapa1 UTSW 12 55795698 missense probably damaging 0.99
R0730:Ralgapa1 UTSW 12 55665663 missense probably damaging 1.00
R0741:Ralgapa1 UTSW 12 55676581 missense probably damaging 0.99
R0815:Ralgapa1 UTSW 12 55762681 nonsense probably null
R0815:Ralgapa1 UTSW 12 55782777 splice site probably benign
R0863:Ralgapa1 UTSW 12 55762681 nonsense probably null
R0863:Ralgapa1 UTSW 12 55782777 splice site probably benign
R1068:Ralgapa1 UTSW 12 55790310 critical splice donor site probably null
R1147:Ralgapa1 UTSW 12 55702480 missense probably damaging 1.00
R1147:Ralgapa1 UTSW 12 55702480 missense probably damaging 1.00
R1256:Ralgapa1 UTSW 12 55762661 missense possibly damaging 0.94
R1343:Ralgapa1 UTSW 12 55707978 missense probably damaging 1.00
R1378:Ralgapa1 UTSW 12 55676926 missense probably damaging 1.00
R1474:Ralgapa1 UTSW 12 55741480 missense probably benign 0.09
R1494:Ralgapa1 UTSW 12 55684524 missense probably damaging 0.99
R1593:Ralgapa1 UTSW 12 55770703 missense probably damaging 1.00
R1607:Ralgapa1 UTSW 12 55741536 missense probably damaging 1.00
R1681:Ralgapa1 UTSW 12 55762603 missense probably benign 0.35
R1689:Ralgapa1 UTSW 12 55676767 missense possibly damaging 0.79
R1714:Ralgapa1 UTSW 12 55642389 missense probably damaging 1.00
R1832:Ralgapa1 UTSW 12 55757967 missense probably benign 0.03
R1870:Ralgapa1 UTSW 12 55677032 missense possibly damaging 0.66
R2040:Ralgapa1 UTSW 12 55786322 missense probably damaging 1.00
R2043:Ralgapa1 UTSW 12 55677026 missense probably damaging 0.99
R2046:Ralgapa1 UTSW 12 55695160 missense probably damaging 1.00
R2109:Ralgapa1 UTSW 12 55776188 missense possibly damaging 0.90
R2114:Ralgapa1 UTSW 12 55786349 critical splice acceptor site probably null
R2115:Ralgapa1 UTSW 12 55786349 critical splice acceptor site probably null
R2202:Ralgapa1 UTSW 12 55612800 intron probably null
R2203:Ralgapa1 UTSW 12 55612800 intron probably null
R2233:Ralgapa1 UTSW 12 55717071 missense probably benign 0.13
R2235:Ralgapa1 UTSW 12 55717071 missense probably benign 0.13
R2341:Ralgapa1 UTSW 12 55677124 missense possibly damaging 0.66
R2507:Ralgapa1 UTSW 12 55718201 missense probably damaging 1.00
R2508:Ralgapa1 UTSW 12 55718201 missense probably damaging 1.00
R2972:Ralgapa1 UTSW 12 55820755 missense possibly damaging 0.61
R3160:Ralgapa1 UTSW 12 55709586 missense probably damaging 1.00
R3162:Ralgapa1 UTSW 12 55709586 missense probably damaging 1.00
R3401:Ralgapa1 UTSW 12 55659137 missense possibly damaging 0.66
R3416:Ralgapa1 UTSW 12 55770613 splice site probably benign
R3499:Ralgapa1 UTSW 12 55695143 splice site probably benign
R3799:Ralgapa1 UTSW 12 55659130 missense probably damaging 1.00
R3948:Ralgapa1 UTSW 12 55698767 missense probably damaging 1.00
R4039:Ralgapa1 UTSW 12 55795701 missense probably damaging 0.99
R4120:Ralgapa1 UTSW 12 55640644 missense probably damaging 1.00
R4165:Ralgapa1 UTSW 12 55640644 missense probably damaging 1.00
R4166:Ralgapa1 UTSW 12 55640644 missense probably damaging 1.00
R4212:Ralgapa1 UTSW 12 55739330 critical splice donor site probably null
R4232:Ralgapa1 UTSW 12 55640644 missense probably damaging 1.00
R4233:Ralgapa1 UTSW 12 55640644 missense probably damaging 1.00
R4234:Ralgapa1 UTSW 12 55640644 missense probably damaging 1.00
R4235:Ralgapa1 UTSW 12 55640644 missense probably damaging 1.00
R4399:Ralgapa1 UTSW 12 55795778 critical splice acceptor site probably null
R4698:Ralgapa1 UTSW 12 55677276 splice site probably null
R4715:Ralgapa1 UTSW 12 55693458 missense probably damaging 1.00
R4755:Ralgapa1 UTSW 12 55712748 missense probably damaging 1.00
R4810:Ralgapa1 UTSW 12 55794993 critical splice donor site probably null
R4827:Ralgapa1 UTSW 12 55676437 missense probably damaging 1.00
R4849:Ralgapa1 UTSW 12 55698803 missense probably damaging 0.99
R4934:Ralgapa1 UTSW 12 55762574 missense possibly damaging 0.94
R5006:Ralgapa1 UTSW 12 55718114 missense probably benign 0.02
R5114:Ralgapa1 UTSW 12 55612723 missense possibly damaging 0.84
R5140:Ralgapa1 UTSW 12 55776152 missense probably damaging 1.00
R5140:Ralgapa1 UTSW 12 55665674 missense probably damaging 1.00
R5168:Ralgapa1 UTSW 12 55758032 missense probably benign 0.05
R5407:Ralgapa1 UTSW 12 55676797 missense possibly damaging 0.93
R5441:Ralgapa1 UTSW 12 55719623 missense probably damaging 1.00
R5473:Ralgapa1 UTSW 12 55676710 missense probably benign 0.41
R5624:Ralgapa1 UTSW 12 55612738 missense probably damaging 1.00
R5766:Ralgapa1 UTSW 12 55820766 start codon destroyed probably null 0.99
R5826:Ralgapa1 UTSW 12 55677113 missense probably damaging 1.00
R5950:Ralgapa1 UTSW 12 55738265 missense possibly damaging 0.58
R5980:Ralgapa1 UTSW 12 55770616 splice site probably null
R6019:Ralgapa1 UTSW 12 55684042 missense possibly damaging 0.92
R6065:Ralgapa1 UTSW 12 55757924 critical splice donor site probably null
R6326:Ralgapa1 UTSW 12 55747146 missense probably damaging 1.00
R6355:Ralgapa1 UTSW 12 55698854 missense probably damaging 1.00
R6408:Ralgapa1 UTSW 12 55683910 nonsense probably null
R6448:Ralgapa1 UTSW 12 55719661 missense probably benign 0.14
R6453:Ralgapa1 UTSW 12 55738319 missense probably damaging 1.00
R6590:Ralgapa1 UTSW 12 55722773 critical splice donor site probably null
R6690:Ralgapa1 UTSW 12 55722773 critical splice donor site probably null
R6738:Ralgapa1 UTSW 12 55762727 missense probably damaging 1.00
R6836:Ralgapa1 UTSW 12 55604273 splice site probably null
R6936:Ralgapa1 UTSW 12 55786212 missense probably damaging 0.99
R6945:Ralgapa1 UTSW 12 55776191 missense possibly damaging 0.64
R7028:Ralgapa1 UTSW 12 55758059 missense probably damaging 1.00
R7075:Ralgapa1 UTSW 12 55820723 missense possibly damaging 0.66
R7076:Ralgapa1 UTSW 12 55721576 missense possibly damaging 0.82
R7098:Ralgapa1 UTSW 12 55790310 critical splice donor site probably null
R7231:Ralgapa1 UTSW 12 55604191 missense probably damaging 1.00
R7254:Ralgapa1 UTSW 12 55695193 missense probably damaging 1.00
R7326:Ralgapa1 UTSW 12 55709004 missense probably damaging 1.00
R7485:Ralgapa1 UTSW 12 55712672 missense probably damaging 1.00
R7580:Ralgapa1 UTSW 12 55718228 missense probably benign 0.00
R7702:Ralgapa1 UTSW 12 55709555 missense probably damaging 1.00
R7702:Ralgapa1 UTSW 12 55709556 missense probably damaging 1.00
R7707:Ralgapa1 UTSW 12 55777292 missense probably null 0.99
R7723:Ralgapa1 UTSW 12 55741513 missense probably benign
R7763:Ralgapa1 UTSW 12 55757955 missense probably benign 0.28
R7791:Ralgapa1 UTSW 12 55741519 missense probably damaging 0.97
R7812:Ralgapa1 UTSW 12 55719628 missense possibly damaging 0.67
R7868:Ralgapa1 UTSW 12 55612638 missense probably benign 0.00
R7895:Ralgapa1 UTSW 12 55747149 missense probably benign 0.44
R7896:Ralgapa1 UTSW 12 55697878 missense probably benign 0.01
R7951:Ralgapa1 UTSW 12 55612638 missense probably benign 0.00
R7978:Ralgapa1 UTSW 12 55747149 missense probably benign 0.44
R7979:Ralgapa1 UTSW 12 55697878 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTACCTACCAACAGGGCTCC -3'
(R):5'- AAGGCACTCATCTGAGAATATAGCAG -3'

Sequencing Primer
(F):5'- CCACCAACTGGATGTTAGTATTTTAC -3'
(R):5'- GATGACGGTGATGATGATG -3'
Posted On2019-11-12