Incidental Mutation 'R7677:Fndc3a'
ID592531
Institutional Source Beutler Lab
Gene Symbol Fndc3a
Ensembl Gene ENSMUSG00000033487
Gene Namefibronectin type III domain containing 3A
Synonyms1700094E19Rik, Fndc3, D14Ertd453e, F730017H24Rik, sys
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.693) question?
Stock #R7677 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location72537946-72710003 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 72567414 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 476 (T476A)
Ref Sequence ENSEMBL: ENSMUSP00000086411 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089017] [ENSMUST00000162478]
Predicted Effect probably benign
Transcript: ENSMUST00000089017
AA Change: T476A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000086411
Gene: ENSMUSG00000033487
AA Change: T476A

DomainStartEndE-ValueType
low complexity region 120 136 N/A INTRINSIC
low complexity region 202 216 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
FN3 266 358 3.05e-6 SMART
FN3 371 452 3.42e-9 SMART
FN3 467 549 1.84e-9 SMART
FN3 564 647 1.06e-5 SMART
FN3 662 744 2.19e-7 SMART
FN3 759 838 5.48e-8 SMART
FN3 864 937 2.28e-5 SMART
FN3 951 1032 3.22e-5 SMART
FN3 1047 1127 5.63e0 SMART
transmembrane domain 1175 1197 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162478
AA Change: T476A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000124637
Gene: ENSMUSG00000033487
AA Change: T476A

DomainStartEndE-ValueType
low complexity region 120 136 N/A INTRINSIC
low complexity region 202 216 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
FN3 266 358 3.05e-6 SMART
FN3 371 452 3.42e-9 SMART
Pfam:fn3 468 540 1.9e-6 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000124218
Gene: ENSMUSG00000033487
AA Change: T431A

DomainStartEndE-ValueType
low complexity region 76 92 N/A INTRINSIC
low complexity region 158 172 N/A INTRINSIC
low complexity region 184 200 N/A INTRINSIC
FN3 222 314 3.05e-6 SMART
FN3 327 408 3.42e-9 SMART
FN3 423 505 1.84e-9 SMART
FN3 520 603 1.06e-5 SMART
FN3 618 700 2.19e-7 SMART
FN3 715 794 5.48e-8 SMART
FN3 820 893 2.28e-5 SMART
FN3 907 988 3.22e-5 SMART
FN3 1003 1083 5.63e0 SMART
transmembrane domain 1131 1153 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Males homozygous for an insertional mutation are sterile; females are fertile. In mutant males, spermatids form multinucleated syncytia and fail to mature, while Sertoli cells exhibit abnormal cytoplasmic vacuoles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,298,349 R2699* probably null Het
Adra2a G A 19: 54,046,944 V244M probably damaging Het
Apba2 A G 7: 64,695,097 S12G probably benign Het
Arhgap20 T A 9: 51,840,398 M383K probably damaging Het
Armc12 T C 17: 28,537,891 V210A probably benign Het
Ash1l A T 3: 89,043,193 H2131L probably damaging Het
Atg5 T C 10: 44,347,039 L219P probably damaging Het
Atp2c2 A T 8: 119,748,176 M507L probably benign Het
Atr T A 9: 95,885,462 L1191I probably damaging Het
B4galt5 T C 2: 167,305,078 T279A probably damaging Het
Bglap2 T C 3: 88,377,973 E62G probably damaging Het
Card6 A G 15: 5,098,444 S1157P unknown Het
Ccdc17 T C 4: 116,597,765 probably null Het
Cdc6 T A 11: 98,919,365 L500* probably null Het
Dst G T 1: 34,169,322 probably null Het
Fbxw7 C T 3: 84,904,066 T166I Het
Fer1l6 T C 15: 58,602,290 V955A probably benign Het
Fezf2 T C 14: 12,344,941 E82G probably benign Het
Flii T C 11: 60,720,145 D486G probably damaging Het
Gbp3 C T 3: 142,560,503 probably benign Het
Gm9268 A C 7: 43,024,739 H414P probably damaging Het
Hebp2 T C 10: 18,545,799 probably benign Het
Hhipl2 T A 1: 183,424,043 M88K possibly damaging Het
Hip1 A G 5: 135,430,317 C605R probably benign Het
Hoxd13 T C 2: 74,668,565 S86P probably benign Het
Hspa12a G T 19: 58,860,885 A2E probably benign Het
Il1rl1 A C 1: 40,446,704 *338C probably null Het
Lrrc37a G T 11: 103,499,638 P1654T probably benign Het
Mybpc3 A T 2: 91,129,031 D704V probably benign Het
Napsa A T 7: 44,581,706 K120* probably null Het
Nat3 A C 8: 67,547,487 Y6S probably damaging Het
Negr1 C T 3: 157,069,186 Q180* probably null Het
Nynrin T A 14: 55,870,236 D933E probably benign Het
Olfr119 T A 17: 37,701,066 I132K probably damaging Het
Olfr1413 C T 1: 92,573,261 T30I not run Het
Olfr167 G A 16: 19,514,928 A236V probably benign Het
Olfr420 A T 1: 174,159,048 I92F probably damaging Het
Olfr894 T A 9: 38,219,028 N65K probably damaging Het
Olfr905 T A 9: 38,473,535 S263T possibly damaging Het
Olfr95 A T 17: 37,211,495 Y119* probably null Het
Pbx1 A T 1: 168,203,426 F208I probably damaging Het
Pcdha11 T C 18: 37,011,552 V232A probably damaging Het
Pcsk5 A G 19: 17,581,229 Y605H possibly damaging Het
Pde3a T A 6: 141,250,257 L223Q probably damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Pitpnm2 G A 5: 124,123,569 R977C probably damaging Het
Pkdrej A C 15: 85,815,587 D2049E probably benign Het
Psmd6 T C 14: 14,120,837 D16G probably benign Het
Pth2r C A 1: 65,388,446 T426N probably benign Het
Ralgapa1 G T 12: 55,659,143 L1865M probably damaging Het
Ryr3 T A 2: 112,833,900 Q1702L probably benign Het
Sars2 A G 7: 28,746,751 Y135C probably benign Het
Sdha G A 13: 74,333,053 R345* probably null Het
Selp A T 1: 164,133,956 S413C probably damaging Het
Sirt2 G A 7: 28,785,410 C221Y probably damaging Het
Skiv2l A T 17: 34,848,164 S100T probably benign Het
Socs7 C A 11: 97,389,642 Q566K probably benign Het
Spdye4c G A 2: 128,594,136 V151M probably benign Het
Srcap A G 7: 127,559,808 D2952G unknown Het
Srd5a2 A T 17: 74,047,754 L25Q probably damaging Het
Srrt A T 5: 137,300,148 V254D probably damaging Het
Tap2 T C 17: 34,205,520 F76L probably benign Het
Tdpoz4 T A 3: 93,797,508 *371R probably null Het
Tm9sf3 A T 19: 41,221,304 F441I probably damaging Het
Tmem259 C T 10: 79,978,580 R314Q probably damaging Het
Trim28 G T 7: 13,028,113 R312L possibly damaging Het
Tsc1 A G 2: 28,672,817 T393A probably benign Het
Txndc11 CCCGCCGCCGCCGCCGC CCCGCCGCCGCCGC 16: 11,134,474 probably benign Het
Ube2v2 T C 16: 15,581,100 T42A probably benign Het
Zfp609 A T 9: 65,697,174 S1342R possibly damaging Het
Zg16 A T 7: 127,050,591 V66E probably damaging Het
Other mutations in Fndc3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00563:Fndc3a APN 14 72559357 splice site probably benign
IGL01120:Fndc3a APN 14 72556662 missense probably benign 0.05
IGL01577:Fndc3a APN 14 72589858 missense probably damaging 0.99
IGL01810:Fndc3a APN 14 72566141 missense probably benign 0.01
IGL01965:Fndc3a APN 14 72540402 missense probably benign 0.09
IGL01992:Fndc3a APN 14 72574556 missense probably benign 0.25
IGL02244:Fndc3a APN 14 72556367 splice site probably benign
IGL02639:Fndc3a APN 14 72574357 missense probably benign 0.08
IGL03076:Fndc3a APN 14 72556468 missense possibly damaging 0.82
IGL03096:Fndc3a APN 14 72599119 missense probably damaging 1.00
PIT4677001:Fndc3a UTSW 14 72574595 missense probably benign 0.02
R0112:Fndc3a UTSW 14 72540495 splice site probably benign
R0379:Fndc3a UTSW 14 72556609 missense probably damaging 1.00
R0381:Fndc3a UTSW 14 72556627 missense probably benign 0.05
R0544:Fndc3a UTSW 14 72557622 splice site probably benign
R1079:Fndc3a UTSW 14 72589807 missense possibly damaging 0.81
R1299:Fndc3a UTSW 14 72566198 splice site probably benign
R1424:Fndc3a UTSW 14 72574371 missense probably damaging 1.00
R1453:Fndc3a UTSW 14 72540328 nonsense probably null
R1478:Fndc3a UTSW 14 72557632 critical splice donor site probably null
R1573:Fndc3a UTSW 14 72568944 missense probably damaging 0.98
R1574:Fndc3a UTSW 14 72556557 missense probably damaging 1.00
R1574:Fndc3a UTSW 14 72556557 missense probably damaging 1.00
R1743:Fndc3a UTSW 14 72652081 missense probably damaging 1.00
R1852:Fndc3a UTSW 14 72556843 missense probably damaging 0.96
R2097:Fndc3a UTSW 14 72574351 critical splice donor site probably null
R2396:Fndc3a UTSW 14 72683683 missense possibly damaging 0.92
R2512:Fndc3a UTSW 14 72556275 missense probably benign 0.00
R3722:Fndc3a UTSW 14 72540208 missense probably benign 0.39
R5470:Fndc3a UTSW 14 72574568 missense possibly damaging 0.83
R5757:Fndc3a UTSW 14 72556585 missense probably benign
R5931:Fndc3a UTSW 14 72568867 missense probably benign
R6188:Fndc3a UTSW 14 72589961 missense probably damaging 0.99
R6297:Fndc3a UTSW 14 72563540 missense probably damaging 0.98
R6638:Fndc3a UTSW 14 72559248 nonsense probably null
R7221:Fndc3a UTSW 14 72556157 missense probably benign
R7571:Fndc3a UTSW 14 72589896 missense probably damaging 0.99
R7744:Fndc3a UTSW 14 72561716 missense possibly damaging 0.95
R7849:Fndc3a UTSW 14 72564660 missense probably benign 0.01
R8027:Fndc3a UTSW 14 72553543 missense probably benign 0.04
R8152:Fndc3a UTSW 14 72574380 missense probably damaging 1.00
R8225:Fndc3a UTSW 14 72557677 missense probably benign 0.00
R8295:Fndc3a UTSW 14 72552519 missense probably benign 0.03
Z1176:Fndc3a UTSW 14 72567373 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AATGGCCAACTCCTGTGGTG -3'
(R):5'- TTGATTTGAACCCCATCACAAC -3'

Sequencing Primer
(F):5'- GACAGTTACTGTATTGGGGTTAACAC -3'
(R):5'- GATTTGAACCCCATCACAACAACAAC -3'
Posted On2019-11-12