Incidental Mutation 'R7677:Fer1l6'
ID 592533
Institutional Source Beutler Lab
Gene Symbol Fer1l6
Ensembl Gene ENSMUSG00000037106
Gene Name fer-1-like 6 (C. elegans)
Synonyms EG631797
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock # R7677 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 58510048-58665092 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 58602290 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 955 (V955A)
Ref Sequence ENSEMBL: ENSMUSP00000125718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161028]
AlphaFold E0CZ42
Predicted Effect probably benign
Transcript: ENSMUST00000161028
AA Change: V955A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000125718
Gene: ENSMUSG00000037106
AA Change: V955A

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
C2 83 179 4.09e-12 SMART
FerI 165 235 2.06e-36 SMART
C2 243 354 5.19e-14 SMART
low complexity region 412 449 N/A INTRINSIC
FerB 714 787 2.53e-45 SMART
C2 829 936 8.84e-8 SMART
C2 1000 1099 3.05e0 SMART
low complexity region 1189 1203 N/A INTRINSIC
low complexity region 1256 1270 N/A INTRINSIC
C2 1361 1460 5.78e-12 SMART
low complexity region 1518 1529 N/A INTRINSIC
C2 1601 1731 1.01e-2 SMART
Pfam:Ferlin_C 1765 1857 2.3e-40 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,298,349 R2699* probably null Het
Adra2a G A 19: 54,046,944 V244M probably damaging Het
Apba2 A G 7: 64,695,097 S12G probably benign Het
Arhgap20 T A 9: 51,840,398 M383K probably damaging Het
Armc12 T C 17: 28,537,891 V210A probably benign Het
Ash1l A T 3: 89,043,193 H2131L probably damaging Het
Atg5 T C 10: 44,347,039 L219P probably damaging Het
Atp2c2 A T 8: 119,748,176 M507L probably benign Het
Atr T A 9: 95,885,462 L1191I probably damaging Het
B4galt5 T C 2: 167,305,078 T279A probably damaging Het
Bglap2 T C 3: 88,377,973 E62G probably damaging Het
Card6 A G 15: 5,098,444 S1157P unknown Het
Ccdc17 T C 4: 116,597,765 probably null Het
Cdc6 T A 11: 98,919,365 L500* probably null Het
Dst G T 1: 34,169,322 probably null Het
Fbxw7 C T 3: 84,904,066 T166I Het
Fezf2 T C 14: 12,344,941 E82G probably benign Het
Flii T C 11: 60,720,145 D486G probably damaging Het
Fndc3a T C 14: 72,567,414 T476A probably benign Het
Gbp3 C T 3: 142,560,503 probably benign Het
Gm9268 A C 7: 43,024,739 H414P probably damaging Het
Hebp2 T C 10: 18,545,799 probably benign Het
Hhipl2 T A 1: 183,424,043 M88K possibly damaging Het
Hip1 A G 5: 135,430,317 C605R probably benign Het
Hoxd13 T C 2: 74,668,565 S86P probably benign Het
Hspa12a G T 19: 58,860,885 A2E probably benign Het
Il1rl1 A C 1: 40,446,704 *338C probably null Het
Lrrc37a G T 11: 103,499,638 P1654T probably benign Het
Mybpc3 A T 2: 91,129,031 D704V probably benign Het
Napsa A T 7: 44,581,706 K120* probably null Het
Nat3 A C 8: 67,547,487 Y6S probably damaging Het
Negr1 C T 3: 157,069,186 Q180* probably null Het
Nynrin T A 14: 55,870,236 D933E probably benign Het
Olfr119 T A 17: 37,701,066 I132K probably damaging Het
Olfr1413 C T 1: 92,573,261 T30I not run Het
Olfr167 G A 16: 19,514,928 A236V probably benign Het
Olfr420 A T 1: 174,159,048 I92F probably damaging Het
Olfr894 T A 9: 38,219,028 N65K probably damaging Het
Olfr905 T A 9: 38,473,535 S263T possibly damaging Het
Olfr95 A T 17: 37,211,495 Y119* probably null Het
Pbx1 A T 1: 168,203,426 F208I probably damaging Het
Pcdha11 T C 18: 37,011,552 V232A probably damaging Het
Pcsk5 A G 19: 17,581,229 Y605H possibly damaging Het
Pde3a T A 6: 141,250,257 L223Q probably damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Pitpnm2 G A 5: 124,123,569 R977C probably damaging Het
Pkdrej A C 15: 85,815,587 D2049E probably benign Het
Psmd6 T C 14: 14,120,837 D16G probably benign Het
Pth2r C A 1: 65,388,446 T426N probably benign Het
Ralgapa1 G T 12: 55,659,143 L1865M probably damaging Het
Ryr3 T A 2: 112,833,900 Q1702L probably benign Het
Sars2 A G 7: 28,746,751 Y135C probably benign Het
Sdha G A 13: 74,333,053 R345* probably null Het
Selp A T 1: 164,133,956 S413C probably damaging Het
Sirt2 G A 7: 28,785,410 C221Y probably damaging Het
Skiv2l A T 17: 34,848,164 S100T probably benign Het
Socs7 C A 11: 97,389,642 Q566K probably benign Het
Spdye4c G A 2: 128,594,136 V151M probably benign Het
Srcap A G 7: 127,559,808 D2952G unknown Het
Srd5a2 A T 17: 74,047,754 L25Q probably damaging Het
Srrt A T 5: 137,300,148 V254D probably damaging Het
Tap2 T C 17: 34,205,520 F76L probably benign Het
Tdpoz4 T A 3: 93,797,508 *371R probably null Het
Tm9sf3 A T 19: 41,221,304 F441I probably damaging Het
Tmem259 C T 10: 79,978,580 R314Q probably damaging Het
Trim28 G T 7: 13,028,113 R312L possibly damaging Het
Tsc1 A G 2: 28,672,817 T393A probably benign Het
Txndc11 CCCGCCGCCGCCGCCGC CCCGCCGCCGCCGC 16: 11,134,474 probably benign Het
Ube2v2 T C 16: 15,581,100 T42A probably benign Het
Zfp609 A T 9: 65,697,174 S1342R possibly damaging Het
Zg16 A T 7: 127,050,591 V66E probably damaging Het
Other mutations in Fer1l6
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0009:Fer1l6 UTSW 15 58662787 missense probably damaging 1.00
R0141:Fer1l6 UTSW 15 58558402 missense probably damaging 1.00
R0178:Fer1l6 UTSW 15 58637914 splice site probably null
R0304:Fer1l6 UTSW 15 58590562 missense probably benign 0.08
R0379:Fer1l6 UTSW 15 58548338 missense probably benign 0.05
R0457:Fer1l6 UTSW 15 58638094 critical splice donor site probably null
R0546:Fer1l6 UTSW 15 58558408 splice site probably null
R0602:Fer1l6 UTSW 15 58577945 missense probably damaging 0.98
R0619:Fer1l6 UTSW 15 58662935 splice site probably null
R0669:Fer1l6 UTSW 15 58553724 splice site probably null
R0854:Fer1l6 UTSW 15 58559188 missense probably benign 0.00
R0948:Fer1l6 UTSW 15 58564075 missense probably benign 0.00
R1180:Fer1l6 UTSW 15 58602311 splice site probably benign
R1483:Fer1l6 UTSW 15 58637970 missense possibly damaging 0.84
R1627:Fer1l6 UTSW 15 58641879 missense probably benign 0.41
R1635:Fer1l6 UTSW 15 58647081 missense probably damaging 1.00
R1834:Fer1l6 UTSW 15 58557869 missense possibly damaging 0.58
R1921:Fer1l6 UTSW 15 58625231 missense probably damaging 1.00
R2000:Fer1l6 UTSW 15 58602311 splice site probably benign
R2041:Fer1l6 UTSW 15 58558306 missense probably damaging 1.00
R2144:Fer1l6 UTSW 15 58627534 missense probably benign
R2145:Fer1l6 UTSW 15 58627534 missense probably benign
R2981:Fer1l6 UTSW 15 58564077 missense probably damaging 0.99
R4164:Fer1l6 UTSW 15 58559238 missense possibly damaging 0.83
R4192:Fer1l6 UTSW 15 58647149 missense probably damaging 1.00
R4273:Fer1l6 UTSW 15 58627522 missense probably benign 0.41
R4573:Fer1l6 UTSW 15 58626280 critical splice donor site probably null
R4581:Fer1l6 UTSW 15 58640226 missense probably damaging 1.00
R4624:Fer1l6 UTSW 15 58553705 missense probably damaging 1.00
R4755:Fer1l6 UTSW 15 58640211 missense probably benign 0.09
R4774:Fer1l6 UTSW 15 58577949 missense probably damaging 0.99
R4894:Fer1l6 UTSW 15 58618902 missense probably damaging 1.00
R4896:Fer1l6 UTSW 15 58638020 missense probably damaging 1.00
R4921:Fer1l6 UTSW 15 58600311 critical splice acceptor site probably null
R4962:Fer1l6 UTSW 15 58571401 missense probably benign 0.03
R5029:Fer1l6 UTSW 15 58643920 missense probably benign 0.00
R5134:Fer1l6 UTSW 15 58640154 missense probably damaging 1.00
R5175:Fer1l6 UTSW 15 58550277 missense probably damaging 1.00
R5227:Fer1l6 UTSW 15 58581903 nonsense probably null
R5561:Fer1l6 UTSW 15 58660825 missense probably damaging 0.97
R5621:Fer1l6 UTSW 15 58558326 missense probably damaging 1.00
R5670:Fer1l6 UTSW 15 58622482 missense probably benign 0.00
R5745:Fer1l6 UTSW 15 58571389 missense probably benign 0.01
R5807:Fer1l6 UTSW 15 58590550 nonsense probably null
R5823:Fer1l6 UTSW 15 58590503 nonsense probably null
R5892:Fer1l6 UTSW 15 58564068 missense probably benign
R6006:Fer1l6 UTSW 15 58647044 missense probably damaging 1.00
R6137:Fer1l6 UTSW 15 58559206 missense probably damaging 0.97
R6195:Fer1l6 UTSW 15 58637957 missense probably damaging 1.00
R6234:Fer1l6 UTSW 15 58560639 missense probably damaging 1.00
R6237:Fer1l6 UTSW 15 58625177 nonsense probably null
R6237:Fer1l6 UTSW 15 58638006 missense probably damaging 1.00
R6271:Fer1l6 UTSW 15 58641918 missense probably benign 0.01
R6336:Fer1l6 UTSW 15 58559232 nonsense probably null
R6784:Fer1l6 UTSW 15 58571426 missense possibly damaging 0.63
R6852:Fer1l6 UTSW 15 58594878 missense probably damaging 1.00
R7030:Fer1l6 UTSW 15 58629378 missense probably damaging 1.00
R7088:Fer1l6 UTSW 15 58564050 missense possibly damaging 0.69
R7181:Fer1l6 UTSW 15 58575297 missense probably benign 0.00
R7226:Fer1l6 UTSW 15 58590535 missense probably benign 0.00
R7266:Fer1l6 UTSW 15 58627597 missense probably benign
R7463:Fer1l6 UTSW 15 58573601 nonsense probably null
R7464:Fer1l6 UTSW 15 58573247 splice site probably null
R7469:Fer1l6 UTSW 15 58590570 splice site probably null
R7483:Fer1l6 UTSW 15 58641945 missense possibly damaging 0.83
R7491:Fer1l6 UTSW 15 58600432 missense probably damaging 1.00
R7534:Fer1l6 UTSW 15 58638026 missense probably damaging 1.00
R7562:Fer1l6 UTSW 15 58560482 missense probably benign 0.00
R7580:Fer1l6 UTSW 15 58558396 missense probably benign 0.41
R7599:Fer1l6 UTSW 15 58627589 missense probably benign
R7607:Fer1l6 UTSW 15 58662732 nonsense probably null
R8202:Fer1l6 UTSW 15 58630637 missense probably damaging 1.00
R8261:Fer1l6 UTSW 15 58560496 missense possibly damaging 0.84
R8847:Fer1l6 UTSW 15 58542163 missense possibly damaging 0.72
R9022:Fer1l6 UTSW 15 58583480 missense probably damaging 0.99
R9030:Fer1l6 UTSW 15 58630745 missense probably damaging 1.00
R9160:Fer1l6 UTSW 15 58643866 missense possibly damaging 0.94
R9180:Fer1l6 UTSW 15 58622381 missense probably benign 0.19
R9289:Fer1l6 UTSW 15 58618917 missense probably damaging 1.00
R9559:Fer1l6 UTSW 15 58557910 missense possibly damaging 0.88
R9562:Fer1l6 UTSW 15 58618521 missense possibly damaging 0.70
R9682:Fer1l6 UTSW 15 58550264 missense probably benign 0.03
R9775:Fer1l6 UTSW 15 58625249 missense probably benign
X0021:Fer1l6 UTSW 15 58569202 nonsense probably null
X0027:Fer1l6 UTSW 15 58629340 missense probably damaging 1.00
X0063:Fer1l6 UTSW 15 58618574 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCTGGCCGGAACTAAGTG -3'
(R):5'- GTGCAACAGTTCTGGAAATAACTTG -3'

Sequencing Primer
(F):5'- CCGGAACTAAGTGGATGCCAATC -3'
(R):5'- AGTTTGTAAACATCAGCTTCCAGGTG -3'
Posted On 2019-11-12