Incidental Mutation 'R7678:Npbwr1'
ID592549
Institutional Source Beutler Lab
Gene Symbol Npbwr1
Ensembl Gene ENSMUSG00000033774
Gene Nameneuropeptides B/W receptor 1
SynonymsGpr7
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7678 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location5913707-5917398 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 5916708 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 196 (Q196K)
Ref Sequence ENSEMBL: ENSMUSP00000046233 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044180]
Predicted Effect probably benign
Transcript: ENSMUST00000044180
AA Change: Q196K

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000046233
Gene: ENSMUSG00000033774
AA Change: Q196K

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srw 44 327 1.3e-7 PFAM
Pfam:7TM_GPCR_Srsx 50 324 8.5e-10 PFAM
Pfam:7tm_1 56 309 1e-48 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (67/68)
MGI Phenotype PHENOTYPE: Homozygous null males develop adult-onset obesity, are hyperphagic, and have decreased energy expenditure and locomotor activity. Plasma levels of glucose, leptin and insulin are elevated in males. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam22 C A 5: 8,087,750 probably null Het
Ank1 A G 8: 23,117,058 D1325G probably damaging Het
Asxl1 T C 2: 153,400,652 S1042P probably damaging Het
Bpifb1 C T 2: 154,202,729 H39Y possibly damaging Het
Capn13 C A 17: 73,315,305 M663I probably damaging Het
Clec2g A G 6: 128,979,437 E72G probably damaging Het
Col12a1 T A 9: 79,651,486 Y1899F probably damaging Het
Ctbp2 A G 7: 133,014,624 V194A probably benign Het
Cttnbp2 G T 6: 18,382,810 L1320I probably damaging Het
E2f2 T A 4: 136,192,826 L374* probably null Het
Echdc3 C T 2: 6,212,876 G29S probably benign Het
Ecm1 A G 3: 95,736,182 S269P probably damaging Het
Elmo2 G A 2: 165,291,744 P775S unknown Het
Eno3 T A 11: 70,659,167 probably null Het
Faf1 G A 4: 109,829,864 R267K probably benign Het
Fam162a G A 16: 36,049,937 probably benign Het
Fam178b T A 1: 36,564,451 D473V probably damaging Het
Fat2 G A 11: 55,282,330 T2519I probably damaging Het
Foxc2 A G 8: 121,118,095 Y494C probably damaging Het
Gcnt2 C A 13: 40,953,719 Q355K probably benign Het
Glg1 G T 8: 111,178,865 H595N probably benign Het
Gm9913 A T 2: 125,506,560 H97L unknown Het
Hbegf T A 18: 36,507,548 N152I possibly damaging Het
Hipk1 G A 3: 103,760,550 T567I probably damaging Het
Idh3a C T 9: 54,595,169 P78S probably damaging Het
Igsf10 A T 3: 59,319,340 M2304K possibly damaging Het
Inf2 A G 12: 112,606,994 T723A unknown Het
Itpr2 A T 6: 146,187,550 F2220Y probably benign Het
Kpnb1 C T 11: 97,169,173 R557Q probably damaging Het
Lefty1 A G 1: 180,936,760 D155G probably damaging Het
Lrp1 A G 10: 127,574,053 C1554R probably damaging Het
Lrrc10 A G 10: 117,045,757 D112G probably benign Het
Med12l A G 3: 59,076,720 E439G probably damaging Het
Ms4a7 A T 19: 11,324,504 F185Y probably benign Het
Mtmr6 T A 14: 60,289,652 M234K probably damaging Het
Myh7b C A 2: 155,617,778 probably null Het
Myo1d T C 11: 80,676,893 M254V possibly damaging Het
Nbas T C 12: 13,415,661 V1368A probably damaging Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Neb A G 2: 52,206,702 V4999A probably damaging Het
Nsd3 A T 8: 25,659,817 E339D possibly damaging Het
Olfr738 T C 14: 50,414,014 F157L probably damaging Het
Olfr776 A G 10: 129,261,068 S36G probably damaging Het
Olfr867 T C 9: 20,054,605 N168S probably damaging Het
Oog4 CAA CA 4: 143,437,452 probably null Het
Plxna1 C T 6: 89,331,900 V1199M probably damaging Het
Ppfibp2 T A 7: 107,716,666 M285K probably damaging Het
Ppip5k1 A G 2: 121,337,661 Y704H probably damaging Het
Ptpn18 G A 1: 34,473,364 D417N possibly damaging Het
Sbspon T C 1: 15,859,058 M170V probably benign Het
Scfd2 A C 5: 74,458,636 F440V probably benign Het
Slc22a19 T A 19: 7,710,937 D86V possibly damaging Het
Smg5 A G 3: 88,353,895 N685S possibly damaging Het
Spata46 A G 1: 170,311,764 R111G possibly damaging Het
Sry A T Y: 2,663,248 D137E possibly damaging Het
Tbkbp1 T C 11: 97,149,483 D35G probably damaging Het
Tcf20 A T 15: 82,851,565 V1895D possibly damaging Het
Tfap4 G T 16: 4,551,766 Q112K possibly damaging Het
Tmem2 C A 19: 21,798,116 T241K probably damaging Het
Trmt10c T A 16: 56,034,939 D111V probably benign Het
Unc80 T C 1: 66,649,722 I2415T probably benign Het
Vmn2r107 A T 17: 20,356,639 M300L probably benign Het
Vmn2r5 A T 3: 64,509,522 F72I probably benign Het
Vmn2r53 T A 7: 12,598,498 H408L probably benign Het
Zan C T 5: 137,463,540 V1126M unknown Het
Zfp493 A T 13: 67,779,695 probably benign Het
Zfp618 C A 4: 63,086,621 A86E probably benign Het
Other mutations in Npbwr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02282:Npbwr1 APN 1 5916965 missense possibly damaging 0.55
R0140:Npbwr1 UTSW 1 5916621 missense probably damaging 1.00
R0585:Npbwr1 UTSW 1 5916458 missense possibly damaging 0.72
R0827:Npbwr1 UTSW 1 5916789 missense possibly damaging 0.85
R1472:Npbwr1 UTSW 1 5916681 missense probably damaging 1.00
R1646:Npbwr1 UTSW 1 5917254 missense probably benign 0.01
R2001:Npbwr1 UTSW 1 5917175 missense possibly damaging 0.81
R2004:Npbwr1 UTSW 1 5916351 missense probably damaging 1.00
R2005:Npbwr1 UTSW 1 5916351 missense probably damaging 1.00
R2006:Npbwr1 UTSW 1 5916351 missense probably damaging 1.00
R2259:Npbwr1 UTSW 1 5916658 missense probably damaging 1.00
R4172:Npbwr1 UTSW 1 5916936 missense probably damaging 1.00
R5614:Npbwr1 UTSW 1 5916811 missense probably damaging 1.00
R6379:Npbwr1 UTSW 1 5917219 missense probably benign 0.03
R7022:Npbwr1 UTSW 1 5917100 missense probably damaging 1.00
R7462:Npbwr1 UTSW 1 5916932 missense probably damaging 1.00
R8441:Npbwr1 UTSW 1 5917178 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- ACTCAGGTGATAAGGCGTCCAG -3'
(R):5'- ACCGATACCTGGTGGTTCTG -3'

Sequencing Primer
(F):5'- TCCAGCAGAGGAGGCACAC -3'
(R):5'- TTCTGGCCACAGCAGAGTC -3'
Posted On2019-11-12