Incidental Mutation 'R7678:Ppip5k1'
ID592559
Institutional Source Beutler Lab
Gene Symbol Ppip5k1
Ensembl Gene ENSMUSG00000033526
Gene Namediphosphoinositol pentakisphosphate kinase 1
SynonymsHisppd2a, B430315C20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.372) question?
Stock #R7678 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location121310561-121355396 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 121337661 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 704 (Y704H)
Ref Sequence ENSEMBL: ENSMUSP00000057632 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052029] [ENSMUST00000110625] [ENSMUST00000110626] [ENSMUST00000110627] [ENSMUST00000110628] [ENSMUST00000155568]
Predicted Effect probably damaging
Transcript: ENSMUST00000052029
AA Change: Y704H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000057632
Gene: ENSMUSG00000033526
AA Change: Y704H

DomainStartEndE-ValueType
low complexity region 35 48 N/A INTRINSIC
PDB:3T99|A 50 377 N/A PDB
Pfam:His_Phos_2 390 906 8.8e-110 PFAM
low complexity region 1163 1181 N/A INTRINSIC
coiled coil region 1402 1430 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110625
AA Change: Y704H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106255
Gene: ENSMUSG00000033526
AA Change: Y704H

DomainStartEndE-ValueType
low complexity region 35 48 N/A INTRINSIC
PDB:3T99|A 50 377 N/A PDB
Pfam:His_Phos_2 390 906 8.5e-110 PFAM
low complexity region 1142 1160 N/A INTRINSIC
coiled coil region 1381 1409 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110626
AA Change: Y704H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106256
Gene: ENSMUSG00000033526
AA Change: Y704H

DomainStartEndE-ValueType
low complexity region 35 48 N/A INTRINSIC
PDB:3T99|A 50 377 N/A PDB
Pfam:His_Phos_2 390 906 1.1e-135 PFAM
low complexity region 1163 1181 N/A INTRINSIC
coiled coil region 1402 1430 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110627
AA Change: Y704H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106257
Gene: ENSMUSG00000033526
AA Change: Y704H

DomainStartEndE-ValueType
low complexity region 35 48 N/A INTRINSIC
PDB:3T99|A 50 377 N/A PDB
Pfam:His_Phos_2 390 906 8.5e-110 PFAM
low complexity region 1142 1160 N/A INTRINSIC
coiled coil region 1381 1409 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110628
AA Change: Y704H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106258
Gene: ENSMUSG00000033526
AA Change: Y704H

DomainStartEndE-ValueType
low complexity region 35 48 N/A INTRINSIC
PDB:3T99|A 50 377 N/A PDB
Pfam:His_Phos_2 390 886 3.9e-101 PFAM
low complexity region 1143 1161 N/A INTRINSIC
coiled coil region 1382 1410 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127255
SMART Domains Protein: ENSMUSP00000118597
Gene: ENSMUSG00000033526

DomainStartEndE-ValueType
Pfam:His_Phos_2 1 54 6.7e-9 PFAM
low complexity region 142 162 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132114
SMART Domains Protein: ENSMUSP00000117948
Gene: ENSMUSG00000033526

DomainStartEndE-ValueType
Pfam:His_Phos_2 1 117 1.4e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132613
Predicted Effect probably benign
Transcript: ENSMUST00000155568
SMART Domains Protein: ENSMUSP00000116335
Gene: ENSMUSG00000033526

DomainStartEndE-ValueType
Pfam:His_Phos_2 1 107 8.6e-23 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a dual functional inositol kinase. The encoded enzyme converts inositol hexakisphosphate to diphosphoinositol pentakisphosphate and diphosphoinositol pentakisphosphate to bis-diphosphoinositol tetrakisphosphate. This protein may be important for intracellular signaling pathways. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 15.[provided by RefSeq, Jun 2010]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam22 C A 5: 8,087,750 probably null Het
Ank1 A G 8: 23,117,058 D1325G probably damaging Het
Asxl1 T C 2: 153,400,652 S1042P probably damaging Het
Bpifb1 C T 2: 154,202,729 H39Y possibly damaging Het
Capn13 C A 17: 73,315,305 M663I probably damaging Het
Clec2g A G 6: 128,979,437 E72G probably damaging Het
Col12a1 T A 9: 79,651,486 Y1899F probably damaging Het
Ctbp2 A G 7: 133,014,624 V194A probably benign Het
Cttnbp2 G T 6: 18,382,810 L1320I probably damaging Het
E2f2 T A 4: 136,192,826 L374* probably null Het
Echdc3 C T 2: 6,212,876 G29S probably benign Het
Ecm1 A G 3: 95,736,182 S269P probably damaging Het
Elmo2 G A 2: 165,291,744 P775S unknown Het
Eno3 T A 11: 70,659,167 probably null Het
Faf1 G A 4: 109,829,864 R267K probably benign Het
Fam162a G A 16: 36,049,937 probably benign Het
Fam178b T A 1: 36,564,451 D473V probably damaging Het
Fat2 G A 11: 55,282,330 T2519I probably damaging Het
Foxc2 A G 8: 121,118,095 Y494C probably damaging Het
Gcnt2 C A 13: 40,953,719 Q355K probably benign Het
Glg1 G T 8: 111,178,865 H595N probably benign Het
Gm9913 A T 2: 125,506,560 H97L unknown Het
Hbegf T A 18: 36,507,548 N152I possibly damaging Het
Hipk1 G A 3: 103,760,550 T567I probably damaging Het
Idh3a C T 9: 54,595,169 P78S probably damaging Het
Igsf10 A T 3: 59,319,340 M2304K possibly damaging Het
Inf2 A G 12: 112,606,994 T723A unknown Het
Itpr2 A T 6: 146,187,550 F2220Y probably benign Het
Kpnb1 C T 11: 97,169,173 R557Q probably damaging Het
Lefty1 A G 1: 180,936,760 D155G probably damaging Het
Lrp1 A G 10: 127,574,053 C1554R probably damaging Het
Lrrc10 A G 10: 117,045,757 D112G probably benign Het
Med12l A G 3: 59,076,720 E439G probably damaging Het
Ms4a7 A T 19: 11,324,504 F185Y probably benign Het
Mtmr6 T A 14: 60,289,652 M234K probably damaging Het
Myh7b C A 2: 155,617,778 probably null Het
Myo1d T C 11: 80,676,893 M254V possibly damaging Het
Nbas T C 12: 13,415,661 V1368A probably damaging Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Neb A G 2: 52,206,702 V4999A probably damaging Het
Npbwr1 G T 1: 5,916,708 Q196K probably benign Het
Nsd3 A T 8: 25,659,817 E339D possibly damaging Het
Olfr738 T C 14: 50,414,014 F157L probably damaging Het
Olfr776 A G 10: 129,261,068 S36G probably damaging Het
Olfr867 T C 9: 20,054,605 N168S probably damaging Het
Oog4 CAA CA 4: 143,437,452 probably null Het
Plxna1 C T 6: 89,331,900 V1199M probably damaging Het
Ppfibp2 T A 7: 107,716,666 M285K probably damaging Het
Ptpn18 G A 1: 34,473,364 D417N possibly damaging Het
Sbspon T C 1: 15,859,058 M170V probably benign Het
Scfd2 A C 5: 74,458,636 F440V probably benign Het
Slc22a19 T A 19: 7,710,937 D86V possibly damaging Het
Smg5 A G 3: 88,353,895 N685S possibly damaging Het
Spata46 A G 1: 170,311,764 R111G possibly damaging Het
Sry A T Y: 2,663,248 D137E possibly damaging Het
Tbkbp1 T C 11: 97,149,483 D35G probably damaging Het
Tcf20 A T 15: 82,851,565 V1895D possibly damaging Het
Tfap4 G T 16: 4,551,766 Q112K possibly damaging Het
Tmem2 C A 19: 21,798,116 T241K probably damaging Het
Trmt10c T A 16: 56,034,939 D111V probably benign Het
Unc80 T C 1: 66,649,722 I2415T probably benign Het
Vmn2r107 A T 17: 20,356,639 M300L probably benign Het
Vmn2r5 A T 3: 64,509,522 F72I probably benign Het
Vmn2r53 T A 7: 12,598,498 H408L probably benign Het
Zan C T 5: 137,463,540 V1126M unknown Het
Zfp493 A T 13: 67,779,695 probably benign Het
Zfp618 C A 4: 63,086,621 A86E probably benign Het
Other mutations in Ppip5k1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00909:Ppip5k1 APN 2 121347358 missense probably damaging 1.00
IGL01154:Ppip5k1 APN 2 121343179 missense probably damaging 1.00
IGL01341:Ppip5k1 APN 2 121343210 nonsense probably null
IGL01704:Ppip5k1 APN 2 121312074 missense possibly damaging 0.74
IGL01949:Ppip5k1 APN 2 121337860 missense probably benign
IGL02101:Ppip5k1 APN 2 121331608 missense possibly damaging 0.84
IGL02499:Ppip5k1 APN 2 121331553 splice site probably null
IGL02701:Ppip5k1 APN 2 121316649 splice site probably null
IGL03188:Ppip5k1 APN 2 121326846 unclassified probably benign
lapidus UTSW 2 121337463 missense probably benign 0.29
Roca UTSW 2 121336751 missense probably damaging 0.98
R0363:Ppip5k1 UTSW 2 121347355 missense probably damaging 1.00
R1315:Ppip5k1 UTSW 2 121312005 missense probably benign 0.13
R1664:Ppip5k1 UTSW 2 121337182 missense probably benign 0.02
R1753:Ppip5k1 UTSW 2 121342631 missense probably damaging 1.00
R1759:Ppip5k1 UTSW 2 121350586 missense probably benign 0.32
R1763:Ppip5k1 UTSW 2 121348547 missense probably damaging 1.00
R2033:Ppip5k1 UTSW 2 121337627 missense probably damaging 1.00
R2037:Ppip5k1 UTSW 2 121343193 missense probably damaging 1.00
R2066:Ppip5k1 UTSW 2 121342871 unclassified probably benign
R2103:Ppip5k1 UTSW 2 121321653 splice site probably null
R3414:Ppip5k1 UTSW 2 121327661 missense probably damaging 0.97
R4022:Ppip5k1 UTSW 2 121337627 missense probably damaging 1.00
R4569:Ppip5k1 UTSW 2 121343563 missense possibly damaging 0.69
R4783:Ppip5k1 UTSW 2 121340848 missense possibly damaging 0.95
R4843:Ppip5k1 UTSW 2 121326887 missense probably damaging 1.00
R4981:Ppip5k1 UTSW 2 121312390 missense probably damaging 1.00
R5353:Ppip5k1 UTSW 2 121311720 missense probably benign 0.00
R5493:Ppip5k1 UTSW 2 121336772 missense probably damaging 1.00
R5654:Ppip5k1 UTSW 2 121316676 missense probably benign 0.00
R5835:Ppip5k1 UTSW 2 121337899 missense probably benign 0.01
R5987:Ppip5k1 UTSW 2 121350491 nonsense probably null
R6076:Ppip5k1 UTSW 2 121337110 missense probably null 1.00
R6088:Ppip5k1 UTSW 2 121337463 missense probably benign 0.29
R6276:Ppip5k1 UTSW 2 121323203 unclassified probably benign
R6555:Ppip5k1 UTSW 2 121337612 missense probably damaging 0.99
R6878:Ppip5k1 UTSW 2 121311936 missense probably benign 0.00
R7075:Ppip5k1 UTSW 2 121321750 missense probably damaging 1.00
R7251:Ppip5k1 UTSW 2 121347571 missense probably benign 0.05
R7332:Ppip5k1 UTSW 2 121311969 missense probably damaging 0.96
R7359:Ppip5k1 UTSW 2 121340848 missense possibly damaging 0.95
R7462:Ppip5k1 UTSW 2 121336751 missense probably damaging 0.98
R7568:Ppip5k1 UTSW 2 121337615 missense probably damaging 1.00
R7654:Ppip5k1 UTSW 2 121348559 missense probably damaging 1.00
R7841:Ppip5k1 UTSW 2 121342795 missense probably benign 0.13
R7877:Ppip5k1 UTSW 2 121316754 missense probably benign 0.01
R7896:Ppip5k1 UTSW 2 121347330 missense probably damaging 1.00
R7901:Ppip5k1 UTSW 2 121311909 missense probably damaging 0.99
R7911:Ppip5k1 UTSW 2 121342658 missense possibly damaging 0.89
R8167:Ppip5k1 UTSW 2 121342801 nonsense probably null
R8179:Ppip5k1 UTSW 2 121341614 critical splice donor site probably null
X0020:Ppip5k1 UTSW 2 121341655 missense probably damaging 0.99
Z1176:Ppip5k1 UTSW 2 121337866 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCCTTATGTGAGACCCACC -3'
(R):5'- CCCAGCTCTGTAGGTTGGTATG -3'

Sequencing Primer
(F):5'- CTGGGGAATGACCACGTCAG -3'
(R):5'- GTTGGTATGAATACTACTGACCGCC -3'
Posted On2019-11-12