Mutagenetix > Incidental Mutation

Incidental Mutation 'R7678:Asxl1'

592561

Institutional Source

Beutler Lab

Gene Symbol

Asxl1

Ensembl Gene

ENSMUSG00000042548

Gene Name

additional sex combs like 1

Synonyms

MMRRC Submission

045745-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7678 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

153345829-153404007 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 153400652 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 1042 (S1042P)

Ref Sequence

ENSEMBL: ENSMUSP00000105413 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000109790] [ENSMUST00000227428]

AlphaFold

P59598

Predicted Effect

probably damaging
Transcript: ENSMUST00000109790
AA Change: S1042P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000105413
Gene: ENSMUSG00000042548
AA Change: S1042P

Domain	Start	End	E-Value	Type
Pfam:HARE-HTH	11	83	1.6e-20	PFAM
low complexity region	199	209	N/A	INTRINSIC
Pfam:ASXH	236	361	5.9e-40	PFAM
low complexity region	411	422	N/A	INTRINSIC
low complexity region	639	667	N/A	INTRINSIC
low complexity region	705	716	N/A	INTRINSIC
low complexity region	848	860	N/A	INTRINSIC
low complexity region	986	1000	N/A	INTRINSIC
Pfam:PHD_3	1446	1512	6.3e-23	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000227428
AA Change: S1041P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

99% (67/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is similar to the Drosophila additional sex combs gene, which encodes a chromatin-binding protein required for normal determination of segment identity in the developing embryo. The protein is a member of the Polycomb group of proteins, which are necessary for the maintenance of stable repression of homeotic and other loci. The protein is thought to disrupt chromatin in localized areas, enhancing transcription of certain genes while repressing the transcription of other genes. The protein encoded by this gene functions as a ligand-dependent co-activator for retinoic acid receptor in cooperation with nuclear receptor coactivator 1. Mutations in this gene are associated with myelodysplastic syndromes and chronic myelomonocytic leukemia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
PHENOTYPE: Disruption of this gene causes alterations in lymphocyte development in adult mice. Mice homozygous for a different knock-out allele exhibit complete lethality. Mice heterozygous for this allele exhibit eye opacity and abnormal vertebrae morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam22	C	A	5: 8,087,750		probably null	Het
Ank1	A	G	8: 23,117,058	D1325G	probably damaging	Het
Bpifb1	C	T	2: 154,202,729	H39Y	possibly damaging	Het
Capn13	C	A	17: 73,315,305	M663I	probably damaging	Het
Clec2g	A	G	6: 128,979,437	E72G	probably damaging	Het
Col12a1	T	A	9: 79,651,486	Y1899F	probably damaging	Het
Ctbp2	A	G	7: 133,014,624	V194A	probably benign	Het
Cttnbp2	G	T	6: 18,382,810	L1320I	probably damaging	Het
E2f2	T	A	4: 136,192,826	L374*	probably null	Het
Echdc3	C	T	2: 6,212,876	G29S	probably benign	Het
Ecm1	A	G	3: 95,736,182	S269P	probably damaging	Het
Elmo2	G	A	2: 165,291,744	P775S	unknown	Het
Eno3	T	A	11: 70,659,167		probably null	Het
Faf1	G	A	4: 109,829,864	R267K	probably benign	Het
Fam162a	G	A	16: 36,049,937		probably benign	Het
Fam178b	T	A	1: 36,564,451	D473V	probably damaging	Het
Fat2	G	A	11: 55,282,330	T2519I	probably damaging	Het
Foxc2	A	G	8: 121,118,095	Y494C	probably damaging	Het
Gcnt2	C	A	13: 40,953,719	Q355K	probably benign	Het
Glg1	G	T	8: 111,178,865	H595N	probably benign	Het
Gm9913	A	T	2: 125,506,560	H97L	unknown	Het
Hbegf	T	A	18: 36,507,548	N152I	possibly damaging	Het
Hipk1	G	A	3: 103,760,550	T567I	probably damaging	Het
Idh3a	C	T	9: 54,595,169	P78S	probably damaging	Het
Igsf10	A	T	3: 59,319,340	M2304K	possibly damaging	Het
Inf2	A	G	12: 112,606,994	T723A	unknown	Het
Itpr2	A	T	6: 146,187,550	F2220Y	probably benign	Het
Kpnb1	C	T	11: 97,169,173	R557Q	probably damaging	Het
Lefty1	A	G	1: 180,936,760	D155G	probably damaging	Het
Lrp1	A	G	10: 127,574,053	C1554R	probably damaging	Het
Lrrc10	A	G	10: 117,045,757	D112G	probably benign	Het
Med12l	A	G	3: 59,076,720	E439G	probably damaging	Het
Ms4a7	A	T	19: 11,324,504	F185Y	probably benign	Het
Mtmr6	T	A	14: 60,289,652	M234K	probably damaging	Het
Myh7b	C	A	2: 155,617,778		probably null	Het
Myo1d	T	C	11: 80,676,893	M254V	possibly damaging	Het
Nbas	T	C	12: 13,415,661	V1368A	probably damaging	Het
Nbeal1	G	C	1: 60,237,151	V684L	probably benign	Het
Neb	A	G	2: 52,206,702	V4999A	probably damaging	Het
Npbwr1	G	T	1: 5,916,708	Q196K	probably benign	Het
Nsd3	A	T	8: 25,659,817	E339D	possibly damaging	Het
Olfr738	T	C	14: 50,414,014	F157L	probably damaging	Het
Olfr776	A	G	10: 129,261,068	S36G	probably damaging	Het
Olfr867	T	C	9: 20,054,605	N168S	probably damaging	Het
Oog4	CAA	CA	4: 143,437,452		probably null	Het
Plxna1	C	T	6: 89,331,900	V1199M	probably damaging	Het
Ppfibp2	T	A	7: 107,716,666	M285K	probably damaging	Het
Ppip5k1	A	G	2: 121,337,661	Y704H	probably damaging	Het
Ptpn18	G	A	1: 34,473,364	D417N	possibly damaging	Het
Sbspon	T	C	1: 15,859,058	M170V	probably benign	Het
Scfd2	A	C	5: 74,458,636	F440V	probably benign	Het
Slc22a19	T	A	19: 7,710,937	D86V	possibly damaging	Het
Smg5	A	G	3: 88,353,895	N685S	possibly damaging	Het
Spata46	A	G	1: 170,311,764	R111G	possibly damaging	Het
Sry	A	T	Y: 2,663,248	D137E	possibly damaging	Het
Tbkbp1	T	C	11: 97,149,483	D35G	probably damaging	Het
Tcf20	A	T	15: 82,851,565	V1895D	possibly damaging	Het
Tfap4	G	T	16: 4,551,766	Q112K	possibly damaging	Het
Tmem2	C	A	19: 21,798,116	T241K	probably damaging	Het
Trmt10c	T	A	16: 56,034,939	D111V	probably benign	Het
Unc80	T	C	1: 66,649,722	I2415T	probably benign	Het
Vmn2r107	A	T	17: 20,356,639	M300L	probably benign	Het
Vmn2r5	A	T	3: 64,509,522	F72I	probably benign	Het
Vmn2r53	T	A	7: 12,598,498	H408L	probably benign	Het
Zan	C	T	5: 137,463,540	V1126M	unknown	Het
Zfp493	A	T	13: 67,779,695		probably benign	Het
Zfp618	C	A	4: 63,086,621	A86E	probably benign	Het

Other mutations in Asxl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01409:Asxl1	APN	2	153392940	splice site	probably benign
IGL01432:Asxl1	APN	2	153400205	missense	probably benign	0.38
IGL01543:Asxl1	APN	2	153401484	missense	probably benign	0.11
IGL02355:Asxl1	APN	2	153401786	missense	probably benign	0.34
IGL02362:Asxl1	APN	2	153401786	missense	probably benign	0.34
IGL02645:Asxl1	APN	2	153392857	missense	possibly damaging	0.94
IGL02696:Asxl1	APN	2	153400195	nonsense	probably null
IGL03365:Asxl1	APN	2	153401754	missense	probably damaging	1.00
IGL03372:Asxl1	APN	2	153400413	missense	probably damaging	0.99
IGL03377:Asxl1	APN	2	153396780	missense	probably damaging	1.00
astrophel	UTSW	2	153400106	missense	possibly damaging	0.75
hairbrush	UTSW	2	153400724	missense	possibly damaging	0.55
R0044:Asxl1	UTSW	2	153400209	missense	probably benign	0.06
R0044:Asxl1	UTSW	2	153400209	missense	probably benign	0.06
R0600:Asxl1	UTSW	2	153399904	missense	probably benign	0.00
R0659:Asxl1	UTSW	2	153400724	missense	possibly damaging	0.55
R0661:Asxl1	UTSW	2	153400724	missense	possibly damaging	0.55
R0684:Asxl1	UTSW	2	153397522	missense	probably damaging	1.00
R1606:Asxl1	UTSW	2	153400455	missense	probably damaging	0.99
R1747:Asxl1	UTSW	2	153393454	missense	possibly damaging	0.86
R1796:Asxl1	UTSW	2	153401606	missense	probably benign	0.31
R1914:Asxl1	UTSW	2	153401906	missense	probably damaging	1.00
R2099:Asxl1	UTSW	2	153352267	missense	possibly damaging	0.95
R2373:Asxl1	UTSW	2	153401900	missense	probably benign	0.13
R2910:Asxl1	UTSW	2	153401039	missense	probably benign	0.00
R3620:Asxl1	UTSW	2	153357155	missense	probably damaging	1.00
R3701:Asxl1	UTSW	2	153399344	missense	probably benign	0.04
R4200:Asxl1	UTSW	2	153400106	missense	possibly damaging	0.75
R4773:Asxl1	UTSW	2	153401985	missense	probably damaging	1.00
R4902:Asxl1	UTSW	2	153399831	missense	probably benign	0.02
R5100:Asxl1	UTSW	2	153397931	missense	probably damaging	1.00
R5102:Asxl1	UTSW	2	153400955	missense	probably benign	0.00
R5166:Asxl1	UTSW	2	153401121	missense	probably damaging	1.00
R5421:Asxl1	UTSW	2	153399584	missense	probably benign	0.04
R5701:Asxl1	UTSW	2	153399489	missense	probably damaging	1.00
R5861:Asxl1	UTSW	2	153399390	missense	probably damaging	0.99
R5973:Asxl1	UTSW	2	153402011	missense	probably damaging	0.97
R6384:Asxl1	UTSW	2	153391824	critical splice donor site	probably null
R7023:Asxl1	UTSW	2	153400549	missense	probably benign	0.00
R7028:Asxl1	UTSW	2	153400107	missense	probably benign	0.00
R7176:Asxl1	UTSW	2	153401988	missense	probably damaging	1.00
R7297:Asxl1	UTSW	2	153397435	missense	probably benign	0.01
R7378:Asxl1	UTSW	2	153401993	missense	probably damaging	1.00
R7464:Asxl1	UTSW	2	153397785	missense	probably benign	0.01
R7686:Asxl1	UTSW	2	153391614	missense	probably damaging	1.00
R7789:Asxl1	UTSW	2	153400023	missense	probably benign	0.00
R7838:Asxl1	UTSW	2	153396813	missense	probably damaging	1.00
R7898:Asxl1	UTSW	2	153399934	missense	possibly damaging	0.65
R8281:Asxl1	UTSW	2	153399401	missense	probably damaging	1.00
R8354:Asxl1	UTSW	2	153393425	missense	probably benign	0.40
R8383:Asxl1	UTSW	2	153393719	missense	probably damaging	1.00
R8995:Asxl1	UTSW	2	153393966	missense	probably damaging	1.00
R9183:Asxl1	UTSW	2	153397920	missense	probably damaging	0.99
X0024:Asxl1	UTSW	2	153401985	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCTCTGAGGACAGCAGTGAG -3'
(R):5'- CCTGGCTCTGTTCTCTAAGTGG -3'

Sequencing Primer
(F):5'- GGTTGATGCAAGTGAAGTCAC -3'
(R):5'- CTTCTGTGACCTGGAGGAAGAACC -3'

Posted On

2019-11-12