Mutagenetix > Incidental Mutation

Incidental Mutation 'R7678:Igsf10'

592565

Institutional Source

Beutler Lab

Gene Symbol

Igsf10

Ensembl Gene

ENSMUSG00000036334

Gene Name

immunoglobulin superfamily, member 10

Synonyms

Adlican2, CMF608, 6530405F15Rik

MMRRC Submission

Accession Numbers

Genbank: NM_001162884; MGI: 1923481

Essential gene?

Probably non essential (E-score: 0.193) question?

Stock #

R7678 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

59316735-59344394 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 59319340 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 2304 (M2304K)

Ref Sequence

ENSEMBL: ENSMUSP00000037246 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039419] [ENSMUST00000040325] [ENSMUST00000164225] [ENSMUST00000193455] [ENSMUST00000194546] [ENSMUST00000199659]

AlphaFold

Q3V1M1

Predicted Effect

possibly damaging
Transcript: ENSMUST00000039419
AA Change: M2304K

PolyPhen 2 Score 0.815 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000037246
Gene: ENSMUSG00000036334
AA Change: M2304K

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
LRRNT	28	61	3.24e-4	SMART
LRR	57	79	9.24e1	SMART
LRR	80	103	2.02e-1	SMART
LRR	104	127	7.16e0	SMART
LRR_TYP	128	151	1.2e-3	SMART
LRR	152	175	1.25e-1	SMART
LRR	188	207	2.33e2	SMART
LRRCT	219	280	4.19e-4	SMART
IGc2	488	558	2.34e-4	SMART
IGc2	586	652	7.88e-11	SMART
low complexity region	917	930	N/A	INTRINSIC
low complexity region	1175	1185	N/A	INTRINSIC
low complexity region	1245	1263	N/A	INTRINSIC
low complexity region	1311	1321	N/A	INTRINSIC
low complexity region	1449	1465	N/A	INTRINSIC
IGc2	1632	1701	7.69e-14	SMART
IGc2	1729	1798	5.07e-14	SMART
IGc2	1826	1895	2.19e-9	SMART
IGc2	1925	1994	4.59e-12	SMART
IGc2	2022	2097	1.33e-8	SMART
IGc2	2125	2191	2.96e-15	SMART
IGc2	2223	2291	2.03e-4	SMART
IGc2	2321	2389	9.99e-13	SMART
IGc2	2416	2484	3.03e-12	SMART
IGc2	2512	2583	7.76e-10	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000040325

SMART Domains

Protein: ENSMUSP00000042269
Gene: ENSMUSG00000056476

Domain	Start	End	E-Value	Type
Med12	101	161	1.71e-24	SMART
low complexity region	216	224	N/A	INTRINSIC
low complexity region	269	278	N/A	INTRINSIC
Pfam:Med12-LCEWAV	282	730	2.6e-207	PFAM
low complexity region	744	758	N/A	INTRINSIC
low complexity region	853	872	N/A	INTRINSIC
low complexity region	1455	1466	N/A	INTRINSIC
low complexity region	1728	1742	N/A	INTRINSIC
low complexity region	1769	1783	N/A	INTRINSIC
Pfam:Med12-PQL	1803	2029	2.3e-14	PFAM
low complexity region	2055	2076	N/A	INTRINSIC
low complexity region	2083	2101	N/A	INTRINSIC
low complexity region	2116	2136	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000164225

SMART Domains

Protein: ENSMUSP00000127038
Gene: ENSMUSG00000056476

Domain	Start	End	E-Value	Type
Med12	101	161	1.71e-24	SMART
low complexity region	216	224	N/A	INTRINSIC
low complexity region	269	278	N/A	INTRINSIC
Pfam:Med12-LCEWAV	283	765	5e-187	PFAM
low complexity region	779	793	N/A	INTRINSIC
low complexity region	888	907	N/A	INTRINSIC
low complexity region	1490	1501	N/A	INTRINSIC
low complexity region	1763	1777	N/A	INTRINSIC
low complexity region	1804	1818	N/A	INTRINSIC
Pfam:Med12-PQL	1840	2063	9.7e-66	PFAM
low complexity region	2090	2111	N/A	INTRINSIC
low complexity region	2118	2136	N/A	INTRINSIC
low complexity region	2151	2171	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000193455
AA Change: M2304K

PolyPhen 2 Score 0.815 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000141971
Gene: ENSMUSG00000036334
AA Change: M2304K

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
LRRNT	28	61	3.24e-4	SMART
LRR	57	79	9.24e1	SMART
LRR	80	103	2.02e-1	SMART
LRR	104	127	7.16e0	SMART
LRR_TYP	128	151	1.2e-3	SMART
LRR	152	175	1.25e-1	SMART
LRR	188	207	2.33e2	SMART
LRRCT	219	280	4.19e-4	SMART
IGc2	488	558	2.34e-4	SMART
IGc2	586	652	7.88e-11	SMART
low complexity region	917	930	N/A	INTRINSIC
low complexity region	1175	1185	N/A	INTRINSIC
low complexity region	1245	1263	N/A	INTRINSIC
low complexity region	1311	1321	N/A	INTRINSIC
low complexity region	1449	1465	N/A	INTRINSIC
IGc2	1632	1701	7.69e-14	SMART
IGc2	1729	1798	5.07e-14	SMART
IGc2	1826	1895	2.19e-9	SMART
IGc2	1925	1994	4.59e-12	SMART
IGc2	2022	2097	1.33e-8	SMART
IGc2	2125	2191	2.96e-15	SMART
IGc2	2223	2291	2.03e-4	SMART
IGc2	2321	2389	9.99e-13	SMART
IGc2	2416	2484	3.03e-12	SMART
IGc2	2512	2583	7.76e-10	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000194546
AA Change: M2304K

PolyPhen 2 Score 0.815 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000141391
Gene: ENSMUSG00000036334
AA Change: M2304K

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
LRRNT	28	61	3.24e-4	SMART
LRR	57	79	9.24e1	SMART
LRR	80	103	2.02e-1	SMART
LRR	104	127	7.16e0	SMART
LRR_TYP	128	151	1.2e-3	SMART
LRR	152	175	1.25e-1	SMART
LRR	188	207	2.33e2	SMART
LRRCT	219	280	4.19e-4	SMART
IGc2	488	558	2.34e-4	SMART
IGc2	586	652	7.88e-11	SMART
low complexity region	917	930	N/A	INTRINSIC
low complexity region	1175	1185	N/A	INTRINSIC
low complexity region	1245	1263	N/A	INTRINSIC
low complexity region	1311	1321	N/A	INTRINSIC
low complexity region	1449	1465	N/A	INTRINSIC
IGc2	1632	1701	7.69e-14	SMART
IGc2	1729	1798	5.07e-14	SMART
IGc2	1826	1895	2.19e-9	SMART
IGc2	1925	1994	4.59e-12	SMART
IGc2	2022	2097	1.33e-8	SMART
IGc2	2125	2191	2.96e-15	SMART
IGc2	2223	2291	2.03e-4	SMART
IGc2	2321	2389	9.99e-13	SMART
IGc2	2416	2484	3.03e-12	SMART
IGc2	2512	2583	7.76e-10	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000197374

Predicted Effect

probably benign
Transcript: ENSMUST00000199659

SMART Domains

Protein: ENSMUSP00000142903
Gene: ENSMUSG00000056476

Domain	Start	End	E-Value	Type
Med12	101	161	1.71e-24	SMART
low complexity region	216	224	N/A	INTRINSIC
low complexity region	269	278	N/A	INTRINSIC
Pfam:Med12-LCEWAV	282	765	5.5e-209	PFAM
low complexity region	779	793	N/A	INTRINSIC
low complexity region	888	907	N/A	INTRINSIC
low complexity region	1490	1501	N/A	INTRINSIC
low complexity region	1761	1775	N/A	INTRINSIC
low complexity region	1802	1816	N/A	INTRINSIC
Pfam:Med12-PQL	1836	2062	1.7e-15	PFAM
low complexity region	2088	2130	N/A	INTRINSIC
low complexity region	2144	2164	N/A	INTRINSIC

Meta Mutation Damage Score

0.1262

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

99% (67/68)

Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam22	C	A	5: 8,087,750		probably null	Het
Ank1	A	G	8: 23,117,058	D1325G	probably damaging	Het
Asxl1	T	C	2: 153,400,652	S1042P	probably damaging	Het
Bpifb1	C	T	2: 154,202,729	H39Y	possibly damaging	Het
Capn13	C	A	17: 73,315,305	M663I	probably damaging	Het
Clec2g	A	G	6: 128,979,437	E72G	probably damaging	Het
Col12a1	T	A	9: 79,651,486	Y1899F	probably damaging	Het
Ctbp2	A	G	7: 133,014,624	V194A	probably benign	Het
Cttnbp2	G	T	6: 18,382,810	L1320I	probably damaging	Het
E2f2	T	A	4: 136,192,826	L374*	probably null	Het
Echdc3	C	T	2: 6,212,876	G29S	probably benign	Het
Ecm1	A	G	3: 95,736,182	S269P	probably damaging	Het
Elmo2	G	A	2: 165,291,744	P775S	unknown	Het
Eno3	T	A	11: 70,659,167		probably null	Het
Faf1	G	A	4: 109,829,864	R267K	probably benign	Het
Fam162a	G	A	16: 36,049,937		probably benign	Het
Fam178b	T	A	1: 36,564,451	D473V	probably damaging	Het
Fat2	G	A	11: 55,282,330	T2519I	probably damaging	Het
Foxc2	A	G	8: 121,118,095	Y494C	probably damaging	Het
Gcnt2	C	A	13: 40,953,719	Q355K	probably benign	Het
Glg1	G	T	8: 111,178,865	H595N	probably benign	Het
Gm9913	A	T	2: 125,506,560	H97L	unknown	Het
Hbegf	T	A	18: 36,507,548	N152I	possibly damaging	Het
Hipk1	G	A	3: 103,760,550	T567I	probably damaging	Het
Idh3a	C	T	9: 54,595,169	P78S	probably damaging	Het
Inf2	A	G	12: 112,606,994	T723A	unknown	Het
Itpr2	A	T	6: 146,187,550	F2220Y	probably benign	Het
Kpnb1	C	T	11: 97,169,173	R557Q	probably damaging	Het
Lefty1	A	G	1: 180,936,760	D155G	probably damaging	Het
Lrp1	A	G	10: 127,574,053	C1554R	probably damaging	Het
Lrrc10	A	G	10: 117,045,757	D112G	probably benign	Het
Med12l	A	G	3: 59,076,720	E439G	probably damaging	Het
Ms4a7	A	T	19: 11,324,504	F185Y	probably benign	Het
Mtmr6	T	A	14: 60,289,652	M234K	probably damaging	Het
Myh7b	C	A	2: 155,617,778		probably null	Het
Myo1d	T	C	11: 80,676,893	M254V	possibly damaging	Het
Nbas	T	C	12: 13,415,661	V1368A	probably damaging	Het
Nbeal1	G	C	1: 60,237,151	V684L	probably benign	Het
Neb	A	G	2: 52,206,702	V4999A	probably damaging	Het
Npbwr1	G	T	1: 5,916,708	Q196K	probably benign	Het
Nsd3	A	T	8: 25,659,817	E339D	possibly damaging	Het
Olfr738	T	C	14: 50,414,014	F157L	probably damaging	Het
Olfr776	A	G	10: 129,261,068	S36G	probably damaging	Het
Olfr867	T	C	9: 20,054,605	N168S	probably damaging	Het
Oog4	CAA	CA	4: 143,437,452		probably null	Het
Plxna1	C	T	6: 89,331,900	V1199M	probably damaging	Het
Ppfibp2	T	A	7: 107,716,666	M285K	probably damaging	Het
Ppip5k1	A	G	2: 121,337,661	Y704H	probably damaging	Het
Ptpn18	G	A	1: 34,473,364	D417N	possibly damaging	Het
Sbspon	T	C	1: 15,859,058	M170V	probably benign	Het
Scfd2	A	C	5: 74,458,636	F440V	probably benign	Het
Slc22a19	T	A	19: 7,710,937	D86V	possibly damaging	Het
Smg5	A	G	3: 88,353,895	N685S	possibly damaging	Het
Spata46	A	G	1: 170,311,764	R111G	possibly damaging	Het
Sry	A	T	Y: 2,663,248	D137E	possibly damaging	Het
Tbkbp1	T	C	11: 97,149,483	D35G	probably damaging	Het
Tcf20	A	T	15: 82,851,565	V1895D	possibly damaging	Het
Tfap4	G	T	16: 4,551,766	Q112K	possibly damaging	Het
Tmem2	C	A	19: 21,798,116	T241K	probably damaging	Het
Trmt10c	T	A	16: 56,034,939	D111V	probably benign	Het
Unc80	T	C	1: 66,649,722	I2415T	probably benign	Het
Vmn2r107	A	T	17: 20,356,639	M300L	probably benign	Het
Vmn2r5	A	T	3: 64,509,522	F72I	probably benign	Het
Vmn2r53	T	A	7: 12,598,498	H408L	probably benign	Het
Zan	C	T	5: 137,463,540	V1126M	unknown	Het
Zfp493	A	T	13: 67,779,695		probably benign	Het
Zfp618	C	A	4: 63,086,621	A86E	probably benign	Het

Other mutations in Igsf10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00773:Igsf10	APN	3	59331539	missense	probably benign	0.03
IGL00790:Igsf10	APN	3	59319517	missense	probably damaging	1.00
IGL00916:Igsf10	APN	3	59331127	missense	probably damaging	0.97
IGL00928:Igsf10	APN	3	59330597	missense	probably benign	0.00
IGL01066:Igsf10	APN	3	59327782	critical splice donor site	probably null
IGL01107:Igsf10	APN	3	59331524	missense	probably damaging	1.00
IGL01420:Igsf10	APN	3	59319650	missense	probably benign	0.02
IGL01533:Igsf10	APN	3	59319230	missense	probably damaging	0.98
IGL01537:Igsf10	APN	3	59330031	missense	probably benign	0.00
IGL01676:Igsf10	APN	3	59326011	missense	probably benign	0.06
IGL01676:Igsf10	APN	3	59329335	missense	probably benign	0.17
IGL01960:Igsf10	APN	3	59318737	missense	probably benign	0.00
IGL02123:Igsf10	APN	3	59318660	missense	probably damaging	0.97
IGL02198:Igsf10	APN	3	59325978	missense	possibly damaging	0.95
IGL02268:Igsf10	APN	3	59331152	nonsense	probably null
IGL02313:Igsf10	APN	3	59330690	missense	probably benign	0.01
IGL02368:Igsf10	APN	3	59328231	missense	probably benign
IGL02494:Igsf10	APN	3	59328006	missense	probably damaging	0.98
IGL02549:Igsf10	APN	3	59329241	missense	probably benign	0.03
IGL02616:Igsf10	APN	3	59318606	missense	probably benign	0.06
IGL02957:Igsf10	APN	3	59330864	missense	probably damaging	1.00
IGL03067:Igsf10	APN	3	59318918	missense	probably benign	0.25
IGL03104:Igsf10	APN	3	59319484	missense	probably damaging	1.00
IGL03124:Igsf10	APN	3	59319665	missense	probably benign	0.01
IGL03212:Igsf10	APN	3	59328165	missense	probably benign	0.09
IGL03347:Igsf10	APN	3	59331900	missense	possibly damaging	0.94
IGL03357:Igsf10	APN	3	59336211	missense	probably benign	0.35
F6893:Igsf10	UTSW	3	59331060	missense	probably damaging	1.00
FR4449:Igsf10	UTSW	3	59319110	missense	probably damaging	1.00
PIT1430001:Igsf10	UTSW	3	59328158	missense	probably benign	0.06
PIT4402001:Igsf10	UTSW	3	59325579	missense	probably benign	0.00
PIT4810001:Igsf10	UTSW	3	59318482	missense	probably damaging	1.00
R0068:Igsf10	UTSW	3	59330624	missense	probably damaging	0.98
R0095:Igsf10	UTSW	3	59331196	nonsense	probably null
R0095:Igsf10	UTSW	3	59331196	nonsense	probably null
R0112:Igsf10	UTSW	3	59326008	missense	probably benign	0.00
R0141:Igsf10	UTSW	3	59330832	missense	probably damaging	1.00
R0538:Igsf10	UTSW	3	59320106	missense	probably damaging	0.99
R0551:Igsf10	UTSW	3	59328668	missense	probably benign	0.01
R0556:Igsf10	UTSW	3	59328875	missense	probably benign	0.02
R0582:Igsf10	UTSW	3	59319767	missense	probably benign	0.00
R0630:Igsf10	UTSW	3	59326062	missense	probably damaging	1.00
R0675:Igsf10	UTSW	3	59328594	missense	probably benign	0.14
R0948:Igsf10	UTSW	3	59331104	missense	probably damaging	1.00
R1252:Igsf10	UTSW	3	59331848	missense	probably benign	0.03
R1412:Igsf10	UTSW	3	59327775	splice site	probably benign
R1473:Igsf10	UTSW	3	59318767	missense	probably damaging	1.00
R1585:Igsf10	UTSW	3	59330417	missense	probably damaging	1.00
R1650:Igsf10	UTSW	3	59326162	missense	probably damaging	1.00
R1660:Igsf10	UTSW	3	59331285	missense	probably damaging	1.00
R1671:Igsf10	UTSW	3	59328500	nonsense	probably null
R1748:Igsf10	UTSW	3	59319093	missense	probably damaging	1.00
R1758:Igsf10	UTSW	3	59329196	missense	probably benign	0.09
R1856:Igsf10	UTSW	3	59331272	missense	possibly damaging	0.63
R1912:Igsf10	UTSW	3	59329572	missense	probably benign	0.40
R2148:Igsf10	UTSW	3	59336577	missense	possibly damaging	0.77
R2155:Igsf10	UTSW	3	59331680	missense	probably damaging	1.00
R2509:Igsf10	UTSW	3	59331866	missense	probably damaging	1.00
R2511:Igsf10	UTSW	3	59331866	missense	probably damaging	1.00
R2680:Igsf10	UTSW	3	59325454	missense	probably benign	0.14
R2913:Igsf10	UTSW	3	59331736	missense	possibly damaging	0.70
R2927:Igsf10	UTSW	3	59329427	missense	probably benign
R3547:Igsf10	UTSW	3	59330541	missense	probably benign	0.02
R3547:Igsf10	UTSW	3	59336514	missense	probably damaging	1.00
R3548:Igsf10	UTSW	3	59336514	missense	probably damaging	1.00
R3620:Igsf10	UTSW	3	59336331	missense	probably damaging	1.00
R3732:Igsf10	UTSW	3	59325714	missense	probably benign	0.29
R3743:Igsf10	UTSW	3	59326125	missense	possibly damaging	0.69
R3973:Igsf10	UTSW	3	59331924	missense	probably damaging	1.00
R4005:Igsf10	UTSW	3	59328560	missense	probably benign	0.00
R4184:Igsf10	UTSW	3	59319731	missense	probably damaging	1.00
R4302:Igsf10	UTSW	3	59318750	missense	probably damaging	1.00
R4404:Igsf10	UTSW	3	59329551	missense	probably benign	0.04
R4575:Igsf10	UTSW	3	59330100	missense	probably benign
R4676:Igsf10	UTSW	3	59325949	missense	probably benign	0.23
R4700:Igsf10	UTSW	3	59320330	missense	probably damaging	0.99
R4765:Igsf10	UTSW	3	59329705	missense	probably benign	0.01
R4986:Igsf10	UTSW	3	59328606	missense	probably benign	0.24
R5012:Igsf10	UTSW	3	59318722	missense	probably damaging	1.00
R5070:Igsf10	UTSW	3	59328293	missense	probably benign	0.02
R5083:Igsf10	UTSW	3	59326273	missense	probably damaging	1.00
R5336:Igsf10	UTSW	3	59320132	missense	probably damaging	1.00
R5462:Igsf10	UTSW	3	59325754	missense	probably damaging	1.00
R5648:Igsf10	UTSW	3	59328153	missense	probably benign	0.01
R5810:Igsf10	UTSW	3	59319071	missense	probably damaging	1.00
R5871:Igsf10	UTSW	3	59330411	missense	possibly damaging	0.83
R5880:Igsf10	UTSW	3	59330831	missense	probably damaging	1.00
R5935:Igsf10	UTSW	3	59328157	missense	probably benign	0.12
R5979:Igsf10	UTSW	3	59336473	missense	probably damaging	1.00
R6145:Igsf10	UTSW	3	59331656	missense	possibly damaging	0.83
R6222:Igsf10	UTSW	3	59318915	missense	possibly damaging	0.90
R6224:Igsf10	UTSW	3	59325510	missense	probably damaging	1.00
R6264:Igsf10	UTSW	3	59328507	missense	possibly damaging	0.88
R6283:Igsf10	UTSW	3	59319449	missense	probably damaging	1.00
R6336:Igsf10	UTSW	3	59330339	missense	probably benign	0.00
R6490:Igsf10	UTSW	3	59329571	missense	probably benign	0.06
R6785:Igsf10	UTSW	3	59319244	missense	probably damaging	1.00
R6873:Igsf10	UTSW	3	59328444	missense	probably benign
R6889:Igsf10	UTSW	3	59331933	missense	probably benign
R7024:Igsf10	UTSW	3	59331701	missense	probably benign	0.00
R7056:Igsf10	UTSW	3	59331080	missense	probably damaging	1.00
R7128:Igsf10	UTSW	3	59328905	missense	probably benign
R7251:Igsf10	UTSW	3	59319454	missense	probably damaging	1.00
R7313:Igsf10	UTSW	3	59329416	missense	probably benign	0.05
R7340:Igsf10	UTSW	3	59325768	missense	probably damaging	1.00
R7447:Igsf10	UTSW	3	59331801	missense	probably benign	0.39
R7506:Igsf10	UTSW	3	59319354	missense	probably damaging	1.00
R7695:Igsf10	UTSW	3	59326191	missense	probably damaging	1.00
R7709:Igsf10	UTSW	3	59331543	missense	probably damaging	0.96
R7749:Igsf10	UTSW	3	59329128	missense	possibly damaging	0.88
R7808:Igsf10	UTSW	3	59328068	missense	probably benign	0.00
R7850:Igsf10	UTSW	3	59319632	missense	probably benign	0.33
R7879:Igsf10	UTSW	3	59330724	missense	probably damaging	1.00
R7886:Igsf10	UTSW	3	59328327	missense	probably benign	0.01
R7891:Igsf10	UTSW	3	59328411	nonsense	probably null
R7946:Igsf10	UTSW	3	59319704	missense	possibly damaging	0.69
R7948:Igsf10	UTSW	3	59331858	missense	probably benign	0.02
R8004:Igsf10	UTSW	3	59329709	missense	probably benign	0.01
R8096:Igsf10	UTSW	3	59328959	missense	probably damaging	0.98
R8141:Igsf10	UTSW	3	59330528	missense	probably damaging	0.96
R8183:Igsf10	UTSW	3	59330615	missense	probably benign	0.04
R8203:Igsf10	UTSW	3	59328833	missense	probably benign	0.11
R8325:Igsf10	UTSW	3	59318533	missense	probably damaging	0.96
R8350:Igsf10	UTSW	3	59331528	missense	probably damaging	1.00
R8387:Igsf10	UTSW	3	59329143	missense	probably damaging	1.00
R8488:Igsf10	UTSW	3	59320010	missense	probably damaging	1.00
R8697:Igsf10	UTSW	3	59318887	missense	probably benign	0.02
R8786:Igsf10	UTSW	3	59330642	missense	probably benign	0.25
R8804:Igsf10	UTSW	3	59336455	missense	probably damaging	1.00
R8886:Igsf10	UTSW	3	59329989	missense	probably benign	0.00
R8902:Igsf10	UTSW	3	59336212	missense	probably benign	0.00
R8906:Igsf10	UTSW	3	59326318	missense	probably benign	0.01
R8917:Igsf10	UTSW	3	59319467	missense	possibly damaging	0.69
R9051:Igsf10	UTSW	3	59329247	missense	probably benign	0.00
R9178:Igsf10	UTSW	3	59326059	missense	possibly damaging	0.69
R9228:Igsf10	UTSW	3	59336422	missense	probably damaging	1.00
R9230:Igsf10	UTSW	3	59336422	missense	probably damaging	1.00
R9231:Igsf10	UTSW	3	59336422	missense	probably damaging	1.00
R9232:Igsf10	UTSW	3	59336422	missense	probably damaging	1.00
R9417:Igsf10	UTSW	3	59329105	missense	possibly damaging	0.94
R9609:Igsf10	UTSW	3	59319448	missense	probably damaging	1.00
R9631:Igsf10	UTSW	3	59330483	missense	probably damaging	1.00
R9689:Igsf10	UTSW	3	59326203	missense	probably damaging	1.00
R9762:Igsf10	UTSW	3	59329685	missense	probably damaging	1.00
R9770:Igsf10	UTSW	3	59319778	missense	probably benign	0.07
R9798:Igsf10	UTSW	3	59331705	missense	probably damaging	1.00
Z1088:Igsf10	UTSW	3	59329938	missense	possibly damaging	0.59
Z1177:Igsf10	UTSW	3	59329605	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- ACAGCGATACTTTCCTGACTTG -3'
(R):5'- CCAGACAATATTTTCCTCACGGC -3'

Sequencing Primer
(F):5'- TGAGAGAACCATTGCTTGCC -3'
(R):5'- TCACGGCTCCATACTACGG -3'

Posted On

2019-11-12