Incidental Mutation 'R7678:Igsf10'
ID 592565
Institutional Source Beutler Lab
Gene Symbol Igsf10
Ensembl Gene ENSMUSG00000036334
Gene Name immunoglobulin superfamily, member 10
Synonyms Adlican2, CMF608, 6530405F15Rik
MMRRC Submission
Accession Numbers

Genbank: NM_001162884; MGI: 1923481

Essential gene? Probably non essential (E-score: 0.193) question?
Stock # R7678 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 59316735-59344394 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 59319340 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 2304 (M2304K)
Ref Sequence ENSEMBL: ENSMUSP00000037246 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039419] [ENSMUST00000040325] [ENSMUST00000164225] [ENSMUST00000193455] [ENSMUST00000194546] [ENSMUST00000199659]
AlphaFold Q3V1M1
Predicted Effect possibly damaging
Transcript: ENSMUST00000039419
AA Change: M2304K

PolyPhen 2 Score 0.815 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000037246
Gene: ENSMUSG00000036334
AA Change: M2304K

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
LRRNT 28 61 3.24e-4 SMART
LRR 57 79 9.24e1 SMART
LRR 80 103 2.02e-1 SMART
LRR 104 127 7.16e0 SMART
LRR_TYP 128 151 1.2e-3 SMART
LRR 152 175 1.25e-1 SMART
LRR 188 207 2.33e2 SMART
LRRCT 219 280 4.19e-4 SMART
IGc2 488 558 2.34e-4 SMART
IGc2 586 652 7.88e-11 SMART
low complexity region 917 930 N/A INTRINSIC
low complexity region 1175 1185 N/A INTRINSIC
low complexity region 1245 1263 N/A INTRINSIC
low complexity region 1311 1321 N/A INTRINSIC
low complexity region 1449 1465 N/A INTRINSIC
IGc2 1632 1701 7.69e-14 SMART
IGc2 1729 1798 5.07e-14 SMART
IGc2 1826 1895 2.19e-9 SMART
IGc2 1925 1994 4.59e-12 SMART
IGc2 2022 2097 1.33e-8 SMART
IGc2 2125 2191 2.96e-15 SMART
IGc2 2223 2291 2.03e-4 SMART
IGc2 2321 2389 9.99e-13 SMART
IGc2 2416 2484 3.03e-12 SMART
IGc2 2512 2583 7.76e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000040325
SMART Domains Protein: ENSMUSP00000042269
Gene: ENSMUSG00000056476

DomainStartEndE-ValueType
Med12 101 161 1.71e-24 SMART
low complexity region 216 224 N/A INTRINSIC
low complexity region 269 278 N/A INTRINSIC
Pfam:Med12-LCEWAV 282 730 2.6e-207 PFAM
low complexity region 744 758 N/A INTRINSIC
low complexity region 853 872 N/A INTRINSIC
low complexity region 1455 1466 N/A INTRINSIC
low complexity region 1728 1742 N/A INTRINSIC
low complexity region 1769 1783 N/A INTRINSIC
Pfam:Med12-PQL 1803 2029 2.3e-14 PFAM
low complexity region 2055 2076 N/A INTRINSIC
low complexity region 2083 2101 N/A INTRINSIC
low complexity region 2116 2136 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164225
SMART Domains Protein: ENSMUSP00000127038
Gene: ENSMUSG00000056476

DomainStartEndE-ValueType
Med12 101 161 1.71e-24 SMART
low complexity region 216 224 N/A INTRINSIC
low complexity region 269 278 N/A INTRINSIC
Pfam:Med12-LCEWAV 283 765 5e-187 PFAM
low complexity region 779 793 N/A INTRINSIC
low complexity region 888 907 N/A INTRINSIC
low complexity region 1490 1501 N/A INTRINSIC
low complexity region 1763 1777 N/A INTRINSIC
low complexity region 1804 1818 N/A INTRINSIC
Pfam:Med12-PQL 1840 2063 9.7e-66 PFAM
low complexity region 2090 2111 N/A INTRINSIC
low complexity region 2118 2136 N/A INTRINSIC
low complexity region 2151 2171 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000193455
AA Change: M2304K

PolyPhen 2 Score 0.815 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000141971
Gene: ENSMUSG00000036334
AA Change: M2304K

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
LRRNT 28 61 3.24e-4 SMART
LRR 57 79 9.24e1 SMART
LRR 80 103 2.02e-1 SMART
LRR 104 127 7.16e0 SMART
LRR_TYP 128 151 1.2e-3 SMART
LRR 152 175 1.25e-1 SMART
LRR 188 207 2.33e2 SMART
LRRCT 219 280 4.19e-4 SMART
IGc2 488 558 2.34e-4 SMART
IGc2 586 652 7.88e-11 SMART
low complexity region 917 930 N/A INTRINSIC
low complexity region 1175 1185 N/A INTRINSIC
low complexity region 1245 1263 N/A INTRINSIC
low complexity region 1311 1321 N/A INTRINSIC
low complexity region 1449 1465 N/A INTRINSIC
IGc2 1632 1701 7.69e-14 SMART
IGc2 1729 1798 5.07e-14 SMART
IGc2 1826 1895 2.19e-9 SMART
IGc2 1925 1994 4.59e-12 SMART
IGc2 2022 2097 1.33e-8 SMART
IGc2 2125 2191 2.96e-15 SMART
IGc2 2223 2291 2.03e-4 SMART
IGc2 2321 2389 9.99e-13 SMART
IGc2 2416 2484 3.03e-12 SMART
IGc2 2512 2583 7.76e-10 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000194546
AA Change: M2304K

PolyPhen 2 Score 0.815 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000141391
Gene: ENSMUSG00000036334
AA Change: M2304K

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
LRRNT 28 61 3.24e-4 SMART
LRR 57 79 9.24e1 SMART
LRR 80 103 2.02e-1 SMART
LRR 104 127 7.16e0 SMART
LRR_TYP 128 151 1.2e-3 SMART
LRR 152 175 1.25e-1 SMART
LRR 188 207 2.33e2 SMART
LRRCT 219 280 4.19e-4 SMART
IGc2 488 558 2.34e-4 SMART
IGc2 586 652 7.88e-11 SMART
low complexity region 917 930 N/A INTRINSIC
low complexity region 1175 1185 N/A INTRINSIC
low complexity region 1245 1263 N/A INTRINSIC
low complexity region 1311 1321 N/A INTRINSIC
low complexity region 1449 1465 N/A INTRINSIC
IGc2 1632 1701 7.69e-14 SMART
IGc2 1729 1798 5.07e-14 SMART
IGc2 1826 1895 2.19e-9 SMART
IGc2 1925 1994 4.59e-12 SMART
IGc2 2022 2097 1.33e-8 SMART
IGc2 2125 2191 2.96e-15 SMART
IGc2 2223 2291 2.03e-4 SMART
IGc2 2321 2389 9.99e-13 SMART
IGc2 2416 2484 3.03e-12 SMART
IGc2 2512 2583 7.76e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000197374
Predicted Effect probably benign
Transcript: ENSMUST00000199659
SMART Domains Protein: ENSMUSP00000142903
Gene: ENSMUSG00000056476

DomainStartEndE-ValueType
Med12 101 161 1.71e-24 SMART
low complexity region 216 224 N/A INTRINSIC
low complexity region 269 278 N/A INTRINSIC
Pfam:Med12-LCEWAV 282 765 5.5e-209 PFAM
low complexity region 779 793 N/A INTRINSIC
low complexity region 888 907 N/A INTRINSIC
low complexity region 1490 1501 N/A INTRINSIC
low complexity region 1761 1775 N/A INTRINSIC
low complexity region 1802 1816 N/A INTRINSIC
Pfam:Med12-PQL 1836 2062 1.7e-15 PFAM
low complexity region 2088 2130 N/A INTRINSIC
low complexity region 2144 2164 N/A INTRINSIC
Meta Mutation Damage Score 0.1262 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (67/68)
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam22 C A 5: 8,087,750 probably null Het
Ank1 A G 8: 23,117,058 D1325G probably damaging Het
Asxl1 T C 2: 153,400,652 S1042P probably damaging Het
Bpifb1 C T 2: 154,202,729 H39Y possibly damaging Het
Capn13 C A 17: 73,315,305 M663I probably damaging Het
Clec2g A G 6: 128,979,437 E72G probably damaging Het
Col12a1 T A 9: 79,651,486 Y1899F probably damaging Het
Ctbp2 A G 7: 133,014,624 V194A probably benign Het
Cttnbp2 G T 6: 18,382,810 L1320I probably damaging Het
E2f2 T A 4: 136,192,826 L374* probably null Het
Echdc3 C T 2: 6,212,876 G29S probably benign Het
Ecm1 A G 3: 95,736,182 S269P probably damaging Het
Elmo2 G A 2: 165,291,744 P775S unknown Het
Eno3 T A 11: 70,659,167 probably null Het
Faf1 G A 4: 109,829,864 R267K probably benign Het
Fam162a G A 16: 36,049,937 probably benign Het
Fam178b T A 1: 36,564,451 D473V probably damaging Het
Fat2 G A 11: 55,282,330 T2519I probably damaging Het
Foxc2 A G 8: 121,118,095 Y494C probably damaging Het
Gcnt2 C A 13: 40,953,719 Q355K probably benign Het
Glg1 G T 8: 111,178,865 H595N probably benign Het
Gm9913 A T 2: 125,506,560 H97L unknown Het
Hbegf T A 18: 36,507,548 N152I possibly damaging Het
Hipk1 G A 3: 103,760,550 T567I probably damaging Het
Idh3a C T 9: 54,595,169 P78S probably damaging Het
Inf2 A G 12: 112,606,994 T723A unknown Het
Itpr2 A T 6: 146,187,550 F2220Y probably benign Het
Kpnb1 C T 11: 97,169,173 R557Q probably damaging Het
Lefty1 A G 1: 180,936,760 D155G probably damaging Het
Lrp1 A G 10: 127,574,053 C1554R probably damaging Het
Lrrc10 A G 10: 117,045,757 D112G probably benign Het
Med12l A G 3: 59,076,720 E439G probably damaging Het
Ms4a7 A T 19: 11,324,504 F185Y probably benign Het
Mtmr6 T A 14: 60,289,652 M234K probably damaging Het
Myh7b C A 2: 155,617,778 probably null Het
Myo1d T C 11: 80,676,893 M254V possibly damaging Het
Nbas T C 12: 13,415,661 V1368A probably damaging Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Neb A G 2: 52,206,702 V4999A probably damaging Het
Npbwr1 G T 1: 5,916,708 Q196K probably benign Het
Nsd3 A T 8: 25,659,817 E339D possibly damaging Het
Olfr738 T C 14: 50,414,014 F157L probably damaging Het
Olfr776 A G 10: 129,261,068 S36G probably damaging Het
Olfr867 T C 9: 20,054,605 N168S probably damaging Het
Oog4 CAA CA 4: 143,437,452 probably null Het
Plxna1 C T 6: 89,331,900 V1199M probably damaging Het
Ppfibp2 T A 7: 107,716,666 M285K probably damaging Het
Ppip5k1 A G 2: 121,337,661 Y704H probably damaging Het
Ptpn18 G A 1: 34,473,364 D417N possibly damaging Het
Sbspon T C 1: 15,859,058 M170V probably benign Het
Scfd2 A C 5: 74,458,636 F440V probably benign Het
Slc22a19 T A 19: 7,710,937 D86V possibly damaging Het
Smg5 A G 3: 88,353,895 N685S possibly damaging Het
Spata46 A G 1: 170,311,764 R111G possibly damaging Het
Sry A T Y: 2,663,248 D137E possibly damaging Het
Tbkbp1 T C 11: 97,149,483 D35G probably damaging Het
Tcf20 A T 15: 82,851,565 V1895D possibly damaging Het
Tfap4 G T 16: 4,551,766 Q112K possibly damaging Het
Tmem2 C A 19: 21,798,116 T241K probably damaging Het
Trmt10c T A 16: 56,034,939 D111V probably benign Het
Unc80 T C 1: 66,649,722 I2415T probably benign Het
Vmn2r107 A T 17: 20,356,639 M300L probably benign Het
Vmn2r5 A T 3: 64,509,522 F72I probably benign Het
Vmn2r53 T A 7: 12,598,498 H408L probably benign Het
Zan C T 5: 137,463,540 V1126M unknown Het
Zfp493 A T 13: 67,779,695 probably benign Het
Zfp618 C A 4: 63,086,621 A86E probably benign Het
Other mutations in Igsf10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00773:Igsf10 APN 3 59331539 missense probably benign 0.03
IGL00790:Igsf10 APN 3 59319517 missense probably damaging 1.00
IGL00916:Igsf10 APN 3 59331127 missense probably damaging 0.97
IGL00928:Igsf10 APN 3 59330597 missense probably benign 0.00
IGL01066:Igsf10 APN 3 59327782 critical splice donor site probably null
IGL01107:Igsf10 APN 3 59331524 missense probably damaging 1.00
IGL01420:Igsf10 APN 3 59319650 missense probably benign 0.02
IGL01533:Igsf10 APN 3 59319230 missense probably damaging 0.98
IGL01537:Igsf10 APN 3 59330031 missense probably benign 0.00
IGL01676:Igsf10 APN 3 59326011 missense probably benign 0.06
IGL01676:Igsf10 APN 3 59329335 missense probably benign 0.17
IGL01960:Igsf10 APN 3 59318737 missense probably benign 0.00
IGL02123:Igsf10 APN 3 59318660 missense probably damaging 0.97
IGL02198:Igsf10 APN 3 59325978 missense possibly damaging 0.95
IGL02268:Igsf10 APN 3 59331152 nonsense probably null
IGL02313:Igsf10 APN 3 59330690 missense probably benign 0.01
IGL02368:Igsf10 APN 3 59328231 missense probably benign
IGL02494:Igsf10 APN 3 59328006 missense probably damaging 0.98
IGL02549:Igsf10 APN 3 59329241 missense probably benign 0.03
IGL02616:Igsf10 APN 3 59318606 missense probably benign 0.06
IGL02957:Igsf10 APN 3 59330864 missense probably damaging 1.00
IGL03067:Igsf10 APN 3 59318918 missense probably benign 0.25
IGL03104:Igsf10 APN 3 59319484 missense probably damaging 1.00
IGL03124:Igsf10 APN 3 59319665 missense probably benign 0.01
IGL03212:Igsf10 APN 3 59328165 missense probably benign 0.09
IGL03347:Igsf10 APN 3 59331900 missense possibly damaging 0.94
IGL03357:Igsf10 APN 3 59336211 missense probably benign 0.35
F6893:Igsf10 UTSW 3 59331060 missense probably damaging 1.00
FR4449:Igsf10 UTSW 3 59319110 missense probably damaging 1.00
PIT1430001:Igsf10 UTSW 3 59328158 missense probably benign 0.06
PIT4402001:Igsf10 UTSW 3 59325579 missense probably benign 0.00
PIT4810001:Igsf10 UTSW 3 59318482 missense probably damaging 1.00
R0068:Igsf10 UTSW 3 59330624 missense probably damaging 0.98
R0095:Igsf10 UTSW 3 59331196 nonsense probably null
R0095:Igsf10 UTSW 3 59331196 nonsense probably null
R0112:Igsf10 UTSW 3 59326008 missense probably benign 0.00
R0141:Igsf10 UTSW 3 59330832 missense probably damaging 1.00
R0538:Igsf10 UTSW 3 59320106 missense probably damaging 0.99
R0551:Igsf10 UTSW 3 59328668 missense probably benign 0.01
R0556:Igsf10 UTSW 3 59328875 missense probably benign 0.02
R0582:Igsf10 UTSW 3 59319767 missense probably benign 0.00
R0630:Igsf10 UTSW 3 59326062 missense probably damaging 1.00
R0675:Igsf10 UTSW 3 59328594 missense probably benign 0.14
R0948:Igsf10 UTSW 3 59331104 missense probably damaging 1.00
R1252:Igsf10 UTSW 3 59331848 missense probably benign 0.03
R1412:Igsf10 UTSW 3 59327775 splice site probably benign
R1473:Igsf10 UTSW 3 59318767 missense probably damaging 1.00
R1585:Igsf10 UTSW 3 59330417 missense probably damaging 1.00
R1650:Igsf10 UTSW 3 59326162 missense probably damaging 1.00
R1660:Igsf10 UTSW 3 59331285 missense probably damaging 1.00
R1671:Igsf10 UTSW 3 59328500 nonsense probably null
R1748:Igsf10 UTSW 3 59319093 missense probably damaging 1.00
R1758:Igsf10 UTSW 3 59329196 missense probably benign 0.09
R1856:Igsf10 UTSW 3 59331272 missense possibly damaging 0.63
R1912:Igsf10 UTSW 3 59329572 missense probably benign 0.40
R2148:Igsf10 UTSW 3 59336577 missense possibly damaging 0.77
R2155:Igsf10 UTSW 3 59331680 missense probably damaging 1.00
R2509:Igsf10 UTSW 3 59331866 missense probably damaging 1.00
R2511:Igsf10 UTSW 3 59331866 missense probably damaging 1.00
R2680:Igsf10 UTSW 3 59325454 missense probably benign 0.14
R2913:Igsf10 UTSW 3 59331736 missense possibly damaging 0.70
R2927:Igsf10 UTSW 3 59329427 missense probably benign
R3547:Igsf10 UTSW 3 59330541 missense probably benign 0.02
R3547:Igsf10 UTSW 3 59336514 missense probably damaging 1.00
R3548:Igsf10 UTSW 3 59336514 missense probably damaging 1.00
R3620:Igsf10 UTSW 3 59336331 missense probably damaging 1.00
R3732:Igsf10 UTSW 3 59325714 missense probably benign 0.29
R3743:Igsf10 UTSW 3 59326125 missense possibly damaging 0.69
R3973:Igsf10 UTSW 3 59331924 missense probably damaging 1.00
R4005:Igsf10 UTSW 3 59328560 missense probably benign 0.00
R4184:Igsf10 UTSW 3 59319731 missense probably damaging 1.00
R4302:Igsf10 UTSW 3 59318750 missense probably damaging 1.00
R4404:Igsf10 UTSW 3 59329551 missense probably benign 0.04
R4575:Igsf10 UTSW 3 59330100 missense probably benign
R4676:Igsf10 UTSW 3 59325949 missense probably benign 0.23
R4700:Igsf10 UTSW 3 59320330 missense probably damaging 0.99
R4765:Igsf10 UTSW 3 59329705 missense probably benign 0.01
R4986:Igsf10 UTSW 3 59328606 missense probably benign 0.24
R5012:Igsf10 UTSW 3 59318722 missense probably damaging 1.00
R5070:Igsf10 UTSW 3 59328293 missense probably benign 0.02
R5083:Igsf10 UTSW 3 59326273 missense probably damaging 1.00
R5336:Igsf10 UTSW 3 59320132 missense probably damaging 1.00
R5462:Igsf10 UTSW 3 59325754 missense probably damaging 1.00
R5648:Igsf10 UTSW 3 59328153 missense probably benign 0.01
R5810:Igsf10 UTSW 3 59319071 missense probably damaging 1.00
R5871:Igsf10 UTSW 3 59330411 missense possibly damaging 0.83
R5880:Igsf10 UTSW 3 59330831 missense probably damaging 1.00
R5935:Igsf10 UTSW 3 59328157 missense probably benign 0.12
R5979:Igsf10 UTSW 3 59336473 missense probably damaging 1.00
R6145:Igsf10 UTSW 3 59331656 missense possibly damaging 0.83
R6222:Igsf10 UTSW 3 59318915 missense possibly damaging 0.90
R6224:Igsf10 UTSW 3 59325510 missense probably damaging 1.00
R6264:Igsf10 UTSW 3 59328507 missense possibly damaging 0.88
R6283:Igsf10 UTSW 3 59319449 missense probably damaging 1.00
R6336:Igsf10 UTSW 3 59330339 missense probably benign 0.00
R6490:Igsf10 UTSW 3 59329571 missense probably benign 0.06
R6785:Igsf10 UTSW 3 59319244 missense probably damaging 1.00
R6873:Igsf10 UTSW 3 59328444 missense probably benign
R6889:Igsf10 UTSW 3 59331933 missense probably benign
R7024:Igsf10 UTSW 3 59331701 missense probably benign 0.00
R7056:Igsf10 UTSW 3 59331080 missense probably damaging 1.00
R7128:Igsf10 UTSW 3 59328905 missense probably benign
R7251:Igsf10 UTSW 3 59319454 missense probably damaging 1.00
R7313:Igsf10 UTSW 3 59329416 missense probably benign 0.05
R7340:Igsf10 UTSW 3 59325768 missense probably damaging 1.00
R7447:Igsf10 UTSW 3 59331801 missense probably benign 0.39
R7506:Igsf10 UTSW 3 59319354 missense probably damaging 1.00
R7695:Igsf10 UTSW 3 59326191 missense probably damaging 1.00
R7709:Igsf10 UTSW 3 59331543 missense probably damaging 0.96
R7749:Igsf10 UTSW 3 59329128 missense possibly damaging 0.88
R7808:Igsf10 UTSW 3 59328068 missense probably benign 0.00
R7850:Igsf10 UTSW 3 59319632 missense probably benign 0.33
R7879:Igsf10 UTSW 3 59330724 missense probably damaging 1.00
R7886:Igsf10 UTSW 3 59328327 missense probably benign 0.01
R7891:Igsf10 UTSW 3 59328411 nonsense probably null
R7946:Igsf10 UTSW 3 59319704 missense possibly damaging 0.69
R7948:Igsf10 UTSW 3 59331858 missense probably benign 0.02
R8004:Igsf10 UTSW 3 59329709 missense probably benign 0.01
R8096:Igsf10 UTSW 3 59328959 missense probably damaging 0.98
R8141:Igsf10 UTSW 3 59330528 missense probably damaging 0.96
R8183:Igsf10 UTSW 3 59330615 missense probably benign 0.04
R8203:Igsf10 UTSW 3 59328833 missense probably benign 0.11
R8325:Igsf10 UTSW 3 59318533 missense probably damaging 0.96
R8350:Igsf10 UTSW 3 59331528 missense probably damaging 1.00
R8387:Igsf10 UTSW 3 59329143 missense probably damaging 1.00
R8488:Igsf10 UTSW 3 59320010 missense probably damaging 1.00
R8697:Igsf10 UTSW 3 59318887 missense probably benign 0.02
R8786:Igsf10 UTSW 3 59330642 missense probably benign 0.25
R8804:Igsf10 UTSW 3 59336455 missense probably damaging 1.00
R8886:Igsf10 UTSW 3 59329989 missense probably benign 0.00
R8902:Igsf10 UTSW 3 59336212 missense probably benign 0.00
R8906:Igsf10 UTSW 3 59326318 missense probably benign 0.01
R8917:Igsf10 UTSW 3 59319467 missense possibly damaging 0.69
R9051:Igsf10 UTSW 3 59329247 missense probably benign 0.00
R9178:Igsf10 UTSW 3 59326059 missense possibly damaging 0.69
R9228:Igsf10 UTSW 3 59336422 missense probably damaging 1.00
R9230:Igsf10 UTSW 3 59336422 missense probably damaging 1.00
R9231:Igsf10 UTSW 3 59336422 missense probably damaging 1.00
R9232:Igsf10 UTSW 3 59336422 missense probably damaging 1.00
R9417:Igsf10 UTSW 3 59329105 missense possibly damaging 0.94
R9609:Igsf10 UTSW 3 59319448 missense probably damaging 1.00
R9631:Igsf10 UTSW 3 59330483 missense probably damaging 1.00
R9689:Igsf10 UTSW 3 59326203 missense probably damaging 1.00
R9762:Igsf10 UTSW 3 59329685 missense probably damaging 1.00
R9770:Igsf10 UTSW 3 59319778 missense probably benign 0.07
R9798:Igsf10 UTSW 3 59331705 missense probably damaging 1.00
Z1088:Igsf10 UTSW 3 59329938 missense possibly damaging 0.59
Z1177:Igsf10 UTSW 3 59329605 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACAGCGATACTTTCCTGACTTG -3'
(R):5'- CCAGACAATATTTTCCTCACGGC -3'

Sequencing Primer
(F):5'- TGAGAGAACCATTGCTTGCC -3'
(R):5'- TCACGGCTCCATACTACGG -3'
Posted On 2019-11-12