Incidental Mutation 'R7678:Ecm1'
ID592568
Institutional Source Beutler Lab
Gene Symbol Ecm1
Ensembl Gene ENSMUSG00000028108
Gene Nameextracellular matrix protein 1
Synonymsp85
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.154) question?
Stock #R7678 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location95734147-95739569 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 95736182 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 269 (S269P)
Ref Sequence ENSEMBL: ENSMUSP00000112665 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029752] [ENSMUST00000029753] [ENSMUST00000074339] [ENSMUST00000117507] [ENSMUST00000123143] [ENSMUST00000128885] [ENSMUST00000131376] [ENSMUST00000137912] [ENSMUST00000147217] [ENSMUST00000153026] [ENSMUST00000163530] [ENSMUST00000196077] [ENSMUST00000199464]
Predicted Effect probably benign
Transcript: ENSMUST00000029752
SMART Domains Protein: ENSMUSP00000029752
Gene: ENSMUSG00000028107

DomainStartEndE-ValueType
Pfam:TGS 66 126 5.6e-14 PFAM
tRNA_SAD 233 282 1.15e-10 SMART
Pfam:tRNA-synt_2b 400 608 2.4e-32 PFAM
Pfam:HGTP_anticodon 620 711 1.5e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000029753
AA Change: S268P

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000029753
Gene: ENSMUSG00000028108
AA Change: S268P

DomainStartEndE-ValueType
Pfam:ECM1 1 558 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000074339
SMART Domains Protein: ENSMUSP00000073946
Gene: ENSMUSG00000028107

DomainStartEndE-ValueType
Pfam:TGS 66 126 1.3e-15 PFAM
tRNA_SAD 233 282 1.15e-10 SMART
Pfam:tRNA-synt_2b 336 519 2.8e-39 PFAM
Pfam:HGTP_anticodon 594 685 5.4e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000117507
AA Change: S269P

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000112665
Gene: ENSMUSG00000028108
AA Change: S269P

DomainStartEndE-ValueType
Pfam:ECM1 1 559 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000123143
AA Change: S252P

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000120300
Gene: ENSMUSG00000028108
AA Change: S252P

DomainStartEndE-ValueType
Pfam:ECM1 1 266 4.4e-132 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128885
SMART Domains Protein: ENSMUSP00000120820
Gene: ENSMUSG00000028108

DomainStartEndE-ValueType
Pfam:ECM1 1 251 1.5e-135 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000131376
AA Change: S285P

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000114659
Gene: ENSMUSG00000028108
AA Change: S285P

DomainStartEndE-ValueType
Pfam:ECM1 1 295 4.2e-146 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137912
SMART Domains Protein: ENSMUSP00000122243
Gene: ENSMUSG00000028108

DomainStartEndE-ValueType
Pfam:ECM1 1 140 1.8e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147217
SMART Domains Protein: ENSMUSP00000115524
Gene: ENSMUSG00000028108

DomainStartEndE-ValueType
Pfam:ECM1 1 80 5.2e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153026
SMART Domains Protein: ENSMUSP00000114747
Gene: ENSMUSG00000028108

DomainStartEndE-ValueType
Pfam:ECM1 1 230 1.3e-100 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163530
SMART Domains Protein: ENSMUSP00000130269
Gene: ENSMUSG00000028107

DomainStartEndE-ValueType
Pfam:TGS 66 126 2.6e-15 PFAM
tRNA_SAD 152 201 1.15e-10 SMART
Pfam:tRNA-synt_2b 255 438 8.6e-40 PFAM
Pfam:HGTP_anticodon 539 630 1.6e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196077
SMART Domains Protein: ENSMUSP00000143722
Gene: ENSMUSG00000028107

DomainStartEndE-ValueType
Pfam:TGS 65 125 5e-13 PFAM
tRNA_SAD 232 264 7.5e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000199464
SMART Domains Protein: ENSMUSP00000143328
Gene: ENSMUSG00000028107

DomainStartEndE-ValueType
Pfam:TGS 66 126 1.1e-13 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a soluble protein that is involved in endochondral bone formation, angiogenesis, and tumor biology. It also interacts with a variety of extracellular and structural proteins, contributing to the maintenance of skin integrity and homeostasis. Mutations in this gene are associated with lipoid proteinosis disorder (also known as hyalinosis cutis et mucosae or Urbach-Wiethe disease) that is characterized by generalized thickening of skin, mucosae and certain viscera. Alternatively spliced transcript variants encoding distinct isoforms have been described for this gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit auto-inflammatory disease and do not survive beyond 6 to 8 weeks of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam22 C A 5: 8,087,750 probably null Het
Ank1 A G 8: 23,117,058 D1325G probably damaging Het
Asxl1 T C 2: 153,400,652 S1042P probably damaging Het
Bpifb1 C T 2: 154,202,729 H39Y possibly damaging Het
Capn13 C A 17: 73,315,305 M663I probably damaging Het
Clec2g A G 6: 128,979,437 E72G probably damaging Het
Col12a1 T A 9: 79,651,486 Y1899F probably damaging Het
Ctbp2 A G 7: 133,014,624 V194A probably benign Het
Cttnbp2 G T 6: 18,382,810 L1320I probably damaging Het
E2f2 T A 4: 136,192,826 L374* probably null Het
Echdc3 C T 2: 6,212,876 G29S probably benign Het
Elmo2 G A 2: 165,291,744 P775S unknown Het
Eno3 T A 11: 70,659,167 probably null Het
Faf1 G A 4: 109,829,864 R267K probably benign Het
Fam162a G A 16: 36,049,937 probably benign Het
Fam178b T A 1: 36,564,451 D473V probably damaging Het
Fat2 G A 11: 55,282,330 T2519I probably damaging Het
Foxc2 A G 8: 121,118,095 Y494C probably damaging Het
Gcnt2 C A 13: 40,953,719 Q355K probably benign Het
Glg1 G T 8: 111,178,865 H595N probably benign Het
Gm9913 A T 2: 125,506,560 H97L unknown Het
Hbegf T A 18: 36,507,548 N152I possibly damaging Het
Hipk1 G A 3: 103,760,550 T567I probably damaging Het
Idh3a C T 9: 54,595,169 P78S probably damaging Het
Igsf10 A T 3: 59,319,340 M2304K possibly damaging Het
Inf2 A G 12: 112,606,994 T723A unknown Het
Itpr2 A T 6: 146,187,550 F2220Y probably benign Het
Kpnb1 C T 11: 97,169,173 R557Q probably damaging Het
Lefty1 A G 1: 180,936,760 D155G probably damaging Het
Lrp1 A G 10: 127,574,053 C1554R probably damaging Het
Lrrc10 A G 10: 117,045,757 D112G probably benign Het
Med12l A G 3: 59,076,720 E439G probably damaging Het
Ms4a7 A T 19: 11,324,504 F185Y probably benign Het
Mtmr6 T A 14: 60,289,652 M234K probably damaging Het
Myh7b C A 2: 155,617,778 probably null Het
Myo1d T C 11: 80,676,893 M254V possibly damaging Het
Nbas T C 12: 13,415,661 V1368A probably damaging Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Neb A G 2: 52,206,702 V4999A probably damaging Het
Npbwr1 G T 1: 5,916,708 Q196K probably benign Het
Nsd3 A T 8: 25,659,817 E339D possibly damaging Het
Olfr738 T C 14: 50,414,014 F157L probably damaging Het
Olfr776 A G 10: 129,261,068 S36G probably damaging Het
Olfr867 T C 9: 20,054,605 N168S probably damaging Het
Oog4 CAA CA 4: 143,437,452 probably null Het
Plxna1 C T 6: 89,331,900 V1199M probably damaging Het
Ppfibp2 T A 7: 107,716,666 M285K probably damaging Het
Ppip5k1 A G 2: 121,337,661 Y704H probably damaging Het
Ptpn18 G A 1: 34,473,364 D417N possibly damaging Het
Sbspon T C 1: 15,859,058 M170V probably benign Het
Scfd2 A C 5: 74,458,636 F440V probably benign Het
Slc22a19 T A 19: 7,710,937 D86V possibly damaging Het
Smg5 A G 3: 88,353,895 N685S possibly damaging Het
Spata46 A G 1: 170,311,764 R111G possibly damaging Het
Sry A T Y: 2,663,248 D137E possibly damaging Het
Tbkbp1 T C 11: 97,149,483 D35G probably damaging Het
Tcf20 A T 15: 82,851,565 V1895D possibly damaging Het
Tfap4 G T 16: 4,551,766 Q112K possibly damaging Het
Tmem2 C A 19: 21,798,116 T241K probably damaging Het
Trmt10c T A 16: 56,034,939 D111V probably benign Het
Unc80 T C 1: 66,649,722 I2415T probably benign Het
Vmn2r107 A T 17: 20,356,639 M300L probably benign Het
Vmn2r5 A T 3: 64,509,522 F72I probably benign Het
Vmn2r53 T A 7: 12,598,498 H408L probably benign Het
Zan C T 5: 137,463,540 V1126M unknown Het
Zfp493 A T 13: 67,779,695 probably benign Het
Zfp618 C A 4: 63,086,621 A86E probably benign Het
Other mutations in Ecm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01634:Ecm1 APN 3 95734899 missense probably damaging 1.00
IGL01686:Ecm1 APN 3 95736064 missense probably benign
IGL01807:Ecm1 APN 3 95736579 missense probably damaging 1.00
IGL01862:Ecm1 APN 3 95734273 missense probably benign 0.08
IGL02006:Ecm1 APN 3 95734244 missense probably damaging 0.98
IGL02134:Ecm1 APN 3 95736187 missense probably damaging 1.00
IGL02210:Ecm1 APN 3 95735977 missense probably damaging 0.97
IGL02813:Ecm1 APN 3 95736786 missense probably damaging 0.99
IGL02959:Ecm1 APN 3 95737677 missense probably damaging 1.00
R0362:Ecm1 UTSW 3 95737057 missense possibly damaging 0.93
R0963:Ecm1 UTSW 3 95736588 missense possibly damaging 0.95
R1181:Ecm1 UTSW 3 95735350 missense possibly damaging 0.85
R1230:Ecm1 UTSW 3 95735426 splice site probably null
R1483:Ecm1 UTSW 3 95735963 missense probably damaging 1.00
R1484:Ecm1 UTSW 3 95735963 missense probably damaging 1.00
R1559:Ecm1 UTSW 3 95735963 missense probably damaging 1.00
R1561:Ecm1 UTSW 3 95735963 missense probably damaging 1.00
R1562:Ecm1 UTSW 3 95735963 missense probably damaging 1.00
R1590:Ecm1 UTSW 3 95735963 missense probably damaging 1.00
R1591:Ecm1 UTSW 3 95735963 missense probably damaging 1.00
R2110:Ecm1 UTSW 3 95735942 missense probably benign 0.14
R3236:Ecm1 UTSW 3 95734846 missense possibly damaging 0.71
R3897:Ecm1 UTSW 3 95735986 missense probably damaging 0.99
R4084:Ecm1 UTSW 3 95734363 missense probably damaging 0.98
R4770:Ecm1 UTSW 3 95737961 unclassified probably benign
R4985:Ecm1 UTSW 3 95736103 missense possibly damaging 0.55
R5506:Ecm1 UTSW 3 95735857 missense probably benign 0.00
R5861:Ecm1 UTSW 3 95736597 missense probably damaging 1.00
R7472:Ecm1 UTSW 3 95735320 missense possibly damaging 0.93
R7704:Ecm1 UTSW 3 95736531 missense probably damaging 0.99
R7864:Ecm1 UTSW 3 95734376 missense probably benign 0.09
Z1088:Ecm1 UTSW 3 95734876 missense probably benign
Z1176:Ecm1 UTSW 3 95734876 missense probably benign
Z1177:Ecm1 UTSW 3 95734876 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCCTTCCATGTGCAAGTGTG -3'
(R):5'- CCGCCTAGACTGTTTGAAGC -3'

Sequencing Primer
(F):5'- CTCAGGAGACAGATGTTTTTGAC -3'
(R):5'- TGTGTCTGCGTGCACAC -3'
Posted On2019-11-12