Incidental Mutation 'R7678:Zfp618'
ID592570
Institutional Source Beutler Lab
Gene Symbol Zfp618
Ensembl Gene ENSMUSG00000028358
Gene Namezinc finger protein 618
SynonymsD430033D05Rik, 2810040O04Rik, 2810031P15Rik, Nedd10
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.226) question?
Stock #R7678 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location62965573-63139708 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 63086621 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 86 (A86E)
Ref Sequence ENSEMBL: ENSMUSP00000030043 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030043] [ENSMUST00000064814] [ENSMUST00000107415]
Predicted Effect probably benign
Transcript: ENSMUST00000030043
AA Change: A86E

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000030043
Gene: ENSMUSG00000028358
AA Change: A86E

DomainStartEndE-ValueType
ZnF_C2H2 90 112 5.06e-2 SMART
ZnF_C2H2 131 153 8.81e-2 SMART
ZnF_C2H2 199 221 2.91e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000064814
SMART Domains Protein: ENSMUSP00000069275
Gene: ENSMUSG00000028358

DomainStartEndE-ValueType
ZnF_C2H2 114 136 5.06e-2 SMART
ZnF_C2H2 155 177 8.81e-2 SMART
ZnF_C2H2 243 265 2.91e-2 SMART
low complexity region 288 295 N/A INTRINSIC
ZnF_C2H2 298 320 2.53e-2 SMART
PDB:2BW3|A 377 690 5e-8 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000107415
AA Change: A142E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103038
Gene: ENSMUSG00000028358
AA Change: A142E

DomainStartEndE-ValueType
ZnF_C2H2 146 168 5.06e-2 SMART
ZnF_C2H2 187 209 8.81e-2 SMART
ZnF_C2H2 255 277 2.91e-2 SMART
low complexity region 381 388 N/A INTRINSIC
ZnF_C2H2 391 413 2.53e-2 SMART
PDB:2BW3|A 479 783 9e-8 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (67/68)
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam22 C A 5: 8,087,750 probably null Het
Ank1 A G 8: 23,117,058 D1325G probably damaging Het
Asxl1 T C 2: 153,400,652 S1042P probably damaging Het
Bpifb1 C T 2: 154,202,729 H39Y possibly damaging Het
Capn13 C A 17: 73,315,305 M663I probably damaging Het
Clec2g A G 6: 128,979,437 E72G probably damaging Het
Col12a1 T A 9: 79,651,486 Y1899F probably damaging Het
Ctbp2 A G 7: 133,014,624 V194A probably benign Het
Cttnbp2 G T 6: 18,382,810 L1320I probably damaging Het
E2f2 T A 4: 136,192,826 L374* probably null Het
Echdc3 C T 2: 6,212,876 G29S probably benign Het
Ecm1 A G 3: 95,736,182 S269P probably damaging Het
Elmo2 G A 2: 165,291,744 P775S unknown Het
Eno3 T A 11: 70,659,167 probably null Het
Faf1 G A 4: 109,829,864 R267K probably benign Het
Fam162a G A 16: 36,049,937 probably benign Het
Fam178b T A 1: 36,564,451 D473V probably damaging Het
Fat2 G A 11: 55,282,330 T2519I probably damaging Het
Foxc2 A G 8: 121,118,095 Y494C probably damaging Het
Gcnt2 C A 13: 40,953,719 Q355K probably benign Het
Glg1 G T 8: 111,178,865 H595N probably benign Het
Gm9913 A T 2: 125,506,560 H97L unknown Het
Hbegf T A 18: 36,507,548 N152I possibly damaging Het
Hipk1 G A 3: 103,760,550 T567I probably damaging Het
Idh3a C T 9: 54,595,169 P78S probably damaging Het
Igsf10 A T 3: 59,319,340 M2304K possibly damaging Het
Inf2 A G 12: 112,606,994 T723A unknown Het
Itpr2 A T 6: 146,187,550 F2220Y probably benign Het
Kpnb1 C T 11: 97,169,173 R557Q probably damaging Het
Lefty1 A G 1: 180,936,760 D155G probably damaging Het
Lrp1 A G 10: 127,574,053 C1554R probably damaging Het
Lrrc10 A G 10: 117,045,757 D112G probably benign Het
Med12l A G 3: 59,076,720 E439G probably damaging Het
Ms4a7 A T 19: 11,324,504 F185Y probably benign Het
Mtmr6 T A 14: 60,289,652 M234K probably damaging Het
Myh7b C A 2: 155,617,778 probably null Het
Myo1d T C 11: 80,676,893 M254V possibly damaging Het
Nbas T C 12: 13,415,661 V1368A probably damaging Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Neb A G 2: 52,206,702 V4999A probably damaging Het
Npbwr1 G T 1: 5,916,708 Q196K probably benign Het
Nsd3 A T 8: 25,659,817 E339D possibly damaging Het
Olfr738 T C 14: 50,414,014 F157L probably damaging Het
Olfr776 A G 10: 129,261,068 S36G probably damaging Het
Olfr867 T C 9: 20,054,605 N168S probably damaging Het
Oog4 CAA CA 4: 143,437,452 probably null Het
Plxna1 C T 6: 89,331,900 V1199M probably damaging Het
Ppfibp2 T A 7: 107,716,666 M285K probably damaging Het
Ppip5k1 A G 2: 121,337,661 Y704H probably damaging Het
Ptpn18 G A 1: 34,473,364 D417N possibly damaging Het
Sbspon T C 1: 15,859,058 M170V probably benign Het
Scfd2 A C 5: 74,458,636 F440V probably benign Het
Slc22a19 T A 19: 7,710,937 D86V possibly damaging Het
Smg5 A G 3: 88,353,895 N685S possibly damaging Het
Spata46 A G 1: 170,311,764 R111G possibly damaging Het
Sry A T Y: 2,663,248 D137E possibly damaging Het
Tbkbp1 T C 11: 97,149,483 D35G probably damaging Het
Tcf20 A T 15: 82,851,565 V1895D possibly damaging Het
Tfap4 G T 16: 4,551,766 Q112K possibly damaging Het
Tmem2 C A 19: 21,798,116 T241K probably damaging Het
Trmt10c T A 16: 56,034,939 D111V probably benign Het
Unc80 T C 1: 66,649,722 I2415T probably benign Het
Vmn2r107 A T 17: 20,356,639 M300L probably benign Het
Vmn2r5 A T 3: 64,509,522 F72I probably benign Het
Vmn2r53 T A 7: 12,598,498 H408L probably benign Het
Zan C T 5: 137,463,540 V1126M unknown Het
Zfp493 A T 13: 67,779,695 probably benign Het
Other mutations in Zfp618
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01301:Zfp618 APN 4 63132826 missense probably damaging 1.00
IGL01563:Zfp618 APN 4 63079896 missense probably benign 0.38
IGL01726:Zfp618 APN 4 63132635 missense probably damaging 1.00
IGL02139:Zfp618 APN 4 63133536 missense probably damaging 1.00
IGL02182:Zfp618 APN 4 63095561 splice site probably benign
IGL02533:Zfp618 APN 4 63089405 missense probably damaging 1.00
IGL03231:Zfp618 APN 4 63094479 missense probably damaging 1.00
IGL03257:Zfp618 APN 4 63132671 missense probably damaging 1.00
ANU18:Zfp618 UTSW 4 63132826 missense probably damaging 1.00
IGL03014:Zfp618 UTSW 4 63080088 missense probably damaging 1.00
R0288:Zfp618 UTSW 4 63132934 missense possibly damaging 0.57
R0408:Zfp618 UTSW 4 63086572 missense probably damaging 0.97
R0685:Zfp618 UTSW 4 63133774 missense probably benign 0.21
R1482:Zfp618 UTSW 4 63115448 missense possibly damaging 0.64
R1585:Zfp618 UTSW 4 63132938 missense probably damaging 1.00
R1649:Zfp618 UTSW 4 63095537 missense probably damaging 1.00
R1744:Zfp618 UTSW 4 63086634 splice site probably benign
R1793:Zfp618 UTSW 4 63133237 missense probably damaging 0.97
R1952:Zfp618 UTSW 4 63132318 splice site probably null
R1996:Zfp618 UTSW 4 63131215 splice site probably null
R3792:Zfp618 UTSW 4 63115491 intron probably benign
R3803:Zfp618 UTSW 4 63133019 missense probably damaging 1.00
R3821:Zfp618 UTSW 4 63133564 missense probably benign 0.00
R3838:Zfp618 UTSW 4 63133564 missense probably benign 0.00
R4009:Zfp618 UTSW 4 63133564 missense probably benign 0.00
R4010:Zfp618 UTSW 4 63133564 missense probably benign 0.00
R4565:Zfp618 UTSW 4 63121351 missense probably damaging 1.00
R4611:Zfp618 UTSW 4 63132979 missense probably damaging 1.00
R5019:Zfp618 UTSW 4 63103552 missense probably damaging 1.00
R5154:Zfp618 UTSW 4 63133209 missense probably damaging 1.00
R5183:Zfp618 UTSW 4 63099282 missense probably benign
R5354:Zfp618 UTSW 4 63080028 missense probably damaging 1.00
R5383:Zfp618 UTSW 4 63095492 missense probably benign 0.33
R5774:Zfp618 UTSW 4 63132562 missense probably damaging 1.00
R5932:Zfp618 UTSW 4 63118566 nonsense probably null
R6101:Zfp618 UTSW 4 63133241 missense probably benign 0.09
R6105:Zfp618 UTSW 4 63133241 missense probably benign 0.09
R6478:Zfp618 UTSW 4 63132706 missense probably damaging 1.00
R6598:Zfp618 UTSW 4 63089399 missense probably damaging 1.00
R7386:Zfp618 UTSW 4 63095385 critical splice donor site probably null
R7666:Zfp618 UTSW 4 63132717 nonsense probably null
R7975:Zfp618 UTSW 4 63131115 missense possibly damaging 0.93
R8276:Zfp618 UTSW 4 63132956 missense probably damaging 1.00
R8421:Zfp618 UTSW 4 63133246 missense probably damaging 1.00
X0011:Zfp618 UTSW 4 63080006 missense probably damaging 0.99
Z1176:Zfp618 UTSW 4 63095497 missense probably benign 0.29
Z1176:Zfp618 UTSW 4 63132763 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- TGTCAGCTAGGAGGACTGAG -3'
(R):5'- TCAAGATCTGCTCACAATGGC -3'

Sequencing Primer
(F):5'- AGGACTGAGGCCCTGATAGC -3'
(R):5'- ATCTGCTCACAATGGCTGGATG -3'
Posted On2019-11-12