Mutagenetix > Incidental Mutation

Incidental Mutation 'R7678:E2f2'

592572

Institutional Source

Beutler Lab

Gene Symbol

E2f2

Ensembl Gene

ENSMUSG00000018983

Gene Name

E2F transcription factor 2

Synonyms

MMRRC Submission

045745-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.440) question?

Stock #

R7678 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

135899705-135923368 bp(+) (GRCm39)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 135920137 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Stop codon at position 374 (L374*)

Ref Sequence

ENSEMBL: ENSMUSP00000050047 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061721]

AlphaFold

P56931

Predicted Effect

probably null
Transcript: ENSMUST00000061721
AA Change: L374*

SMART Domains

Protein: ENSMUSP00000050047
Gene: ENSMUSG00000018983
AA Change: L374*

Domain	Start	End	E-Value	Type
low complexity region	41	54	N/A	INTRINSIC
E2F_TDP	131	196	2.93e-32	SMART
Pfam:E2F_CC-MB	212	306	3.1e-38	PFAM
low complexity region	348	376	N/A	INTRINSIC

Meta Mutation Damage Score

0.9712

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

99% (67/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the E2F family of transcription factors. The E2F family plays a crucial role in the control of cell cycle and action of tumor suppressor proteins and is also a target of the transforming proteins of small DNA tumor viruses. The E2F proteins contain several evolutionally conserved domains found in most members of the family. These domains include a DNA binding domain, a dimerization domain which determines interaction with the differentiation regulated transcription factor proteins (DP), a transactivation domain enriched in acidic amino acids, and a tumor suppressor protein association domain which is embedded within the transactivation domain. This protein and another 2 members, E2F1 and E2F3, have an additional cyclin binding domain. This protein binds specifically to retinoblastoma protein pRB in a cell-cycle dependent manner, and it exhibits overall 46% amino acid identity to E2F1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit premature death with signs of inflammatory and autoimmune disorders such as increased memory T cells, enlarged spleen, glomerulonephritis, inflammed liver, inflammed lung, increased double stranded DNA antibodies, hair loss, and erythema. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam22	C	A	5: 8,137,750 (GRCm39)		probably null	Het
Ank1	A	G	8: 23,607,074 (GRCm39)	D1325G	probably damaging	Het
Asxl1	T	C	2: 153,242,572 (GRCm39)	S1042P	probably damaging	Het
Bpifb1	C	T	2: 154,044,649 (GRCm39)	H39Y	possibly damaging	Het
Capn13	C	A	17: 73,622,300 (GRCm39)	M663I	probably damaging	Het
Cemip2	C	A	19: 21,775,480 (GRCm39)	T241K	probably damaging	Het
Clec2g	A	G	6: 128,956,400 (GRCm39)	E72G	probably damaging	Het
Col12a1	T	A	9: 79,558,768 (GRCm39)	Y1899F	probably damaging	Het
Ctbp2	A	G	7: 132,616,353 (GRCm39)	V194A	probably benign	Het
Cttnbp2	G	T	6: 18,382,809 (GRCm39)	L1320I	probably damaging	Het
Echdc3	C	T	2: 6,217,687 (GRCm39)	G29S	probably benign	Het
Ecm1	A	G	3: 95,643,494 (GRCm39)	S269P	probably damaging	Het
Elmo2	G	A	2: 165,133,664 (GRCm39)	P775S	unknown	Het
Eno3	T	A	11: 70,549,993 (GRCm39)		probably null	Het
Faf1	G	A	4: 109,687,061 (GRCm39)	R267K	probably benign	Het
Fam162a	G	A	16: 35,870,307 (GRCm39)		probably benign	Het
Fam178b	T	A	1: 36,603,532 (GRCm39)	D473V	probably damaging	Het
Fat2	G	A	11: 55,173,156 (GRCm39)	T2519I	probably damaging	Het
Foxc2	A	G	8: 121,844,834 (GRCm39)	Y494C	probably damaging	Het
Gcnt2	C	A	13: 41,107,195 (GRCm39)	Q355K	probably benign	Het
Glg1	G	T	8: 111,905,497 (GRCm39)	H595N	probably benign	Het
Gm9913	A	T	2: 125,348,480 (GRCm39)	H97L	unknown	Het
Hbegf	T	A	18: 36,640,601 (GRCm39)	N152I	possibly damaging	Het
Hipk1	G	A	3: 103,667,866 (GRCm39)	T567I	probably damaging	Het
Idh3a	C	T	9: 54,502,453 (GRCm39)	P78S	probably damaging	Het
Igsf10	A	T	3: 59,226,761 (GRCm39)	M2304K	possibly damaging	Het
Inf2	A	G	12: 112,573,428 (GRCm39)	T723A	unknown	Het
Itpr2	A	T	6: 146,089,048 (GRCm39)	F2220Y	probably benign	Het
Kpnb1	C	T	11: 97,059,999 (GRCm39)	R557Q	probably damaging	Het
Lefty1	A	G	1: 180,764,325 (GRCm39)	D155G	probably damaging	Het
Lrp1	A	G	10: 127,409,922 (GRCm39)	C1554R	probably damaging	Het
Lrrc10	A	G	10: 116,881,662 (GRCm39)	D112G	probably benign	Het
Med12l	A	G	3: 58,984,141 (GRCm39)	E439G	probably damaging	Het
Ms4a7	A	T	19: 11,301,868 (GRCm39)	F185Y	probably benign	Het
Mtmr6	T	A	14: 60,527,101 (GRCm39)	M234K	probably damaging	Het
Myh7b	C	A	2: 155,459,698 (GRCm39)		probably null	Het
Myo1d	T	C	11: 80,567,719 (GRCm39)	M254V	possibly damaging	Het
Nbas	T	C	12: 13,465,662 (GRCm39)	V1368A	probably damaging	Het
Nbeal1	G	C	1: 60,276,310 (GRCm39)	V684L	probably benign	Het
Neb	A	G	2: 52,096,714 (GRCm39)	V4999A	probably damaging	Het
Npbwr1	G	T	1: 5,986,927 (GRCm39)	Q196K	probably benign	Het
Nsd3	A	T	8: 26,149,833 (GRCm39)	E339D	possibly damaging	Het
Oog4	CAA	CA	4: 143,164,022 (GRCm39)		probably null	Het
Or11g1	T	C	14: 50,651,471 (GRCm39)	F157L	probably damaging	Het
Or6c206	A	G	10: 129,096,937 (GRCm39)	S36G	probably damaging	Het
Or7d11	T	C	9: 19,965,901 (GRCm39)	N168S	probably damaging	Het
Plxna1	C	T	6: 89,308,882 (GRCm39)	V1199M	probably damaging	Het
Ppfibp2	T	A	7: 107,315,873 (GRCm39)	M285K	probably damaging	Het
Ppip5k1	A	G	2: 121,168,142 (GRCm39)	Y704H	probably damaging	Het
Ptpn18	G	A	1: 34,512,445 (GRCm39)	D417N	possibly damaging	Het
Sbspon	T	C	1: 15,929,282 (GRCm39)	M170V	probably benign	Het
Scfd2	A	C	5: 74,619,297 (GRCm39)	F440V	probably benign	Het
Slc22a19	T	A	19: 7,688,302 (GRCm39)	D86V	possibly damaging	Het
Smg5	A	G	3: 88,261,202 (GRCm39)	N685S	possibly damaging	Het
Spata46	A	G	1: 170,139,333 (GRCm39)	R111G	possibly damaging	Het
Sry	A	T	Y: 2,663,248 (GRCm39)	D137E	possibly damaging	Het
Tbkbp1	T	C	11: 97,040,309 (GRCm39)	D35G	probably damaging	Het
Tcf20	A	T	15: 82,735,766 (GRCm39)	V1895D	possibly damaging	Het
Tfap4	G	T	16: 4,369,630 (GRCm39)	Q112K	possibly damaging	Het
Trmt10c	T	A	16: 55,855,302 (GRCm39)	D111V	probably benign	Het
Unc80	T	C	1: 66,688,881 (GRCm39)	I2415T	probably benign	Het
Vmn2r107	A	T	17: 20,576,901 (GRCm39)	M300L	probably benign	Het
Vmn2r5	A	T	3: 64,416,943 (GRCm39)	F72I	probably benign	Het
Vmn2r53	T	A	7: 12,332,425 (GRCm39)	H408L	probably benign	Het
Zan	C	T	5: 137,461,802 (GRCm39)	V1126M	unknown	Het
Zfp493	A	T	13: 67,927,814 (GRCm39)		probably benign	Het
Zfp618	C	A	4: 63,004,858 (GRCm39)	A86E	probably benign	Het

Other mutations in E2f2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01796:E2f2	APN	4	135,907,728 (GRCm39)	nonsense	probably null
IGL02078:E2f2	APN	4	135,920,323 (GRCm39)	missense	probably damaging	1.00
IGL02112:E2f2	APN	4	135,920,145 (GRCm39)	missense	probably benign	0.08
IGL02123:E2f2	APN	4	135,900,159 (GRCm39)	missense	probably benign	0.00
R0398:E2f2	UTSW	4	135,907,855 (GRCm39)	missense	probably damaging	1.00
R1594:E2f2	UTSW	4	135,914,141 (GRCm39)	missense	possibly damaging	0.85
R4729:E2f2	UTSW	4	135,911,760 (GRCm39)	missense	probably damaging	0.99
R5092:E2f2	UTSW	4	135,914,248 (GRCm39)	missense	probably benign	0.04
R5184:E2f2	UTSW	4	135,911,751 (GRCm39)	missense	possibly damaging	0.95
R5462:E2f2	UTSW	4	135,900,224 (GRCm39)	missense	probably benign	0.06
R5987:E2f2	UTSW	4	135,900,245 (GRCm39)	missense	probably benign	0.00
R6237:E2f2	UTSW	4	135,905,796 (GRCm39)	missense	possibly damaging	0.48
R8247:E2f2	UTSW	4	135,900,126 (GRCm39)	missense	possibly damaging	0.76
R8261:E2f2	UTSW	4	135,911,791 (GRCm39)	synonymous	silent
R9147:E2f2	UTSW	4	135,908,595 (GRCm39)	critical splice acceptor site	probably null
R9148:E2f2	UTSW	4	135,908,595 (GRCm39)	critical splice acceptor site	probably null
R9606:E2f2	UTSW	4	135,911,743 (GRCm39)	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CACGGGAGAATGGAGTTTCTG -3'
(R):5'- ACAGGTCCCCAAGGTCATAG -3'

Sequencing Primer
(F):5'- TGACTGGAGCCTGGAGAGATC -3'
(R):5'- TCCCCAAGGTCATAGGAGTC -3'

Posted On

2019-11-12