Incidental Mutation 'R7678:Plxna1'
ID592577
Institutional Source Beutler Lab
Gene Symbol Plxna1
Ensembl Gene ENSMUSG00000030084
Gene Nameplexin A1
SynonymsNOV, Plxn1, PlexA1, 2600013D04Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.842) question?
Stock #R7678 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location89316314-89362620 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 89331900 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 1199 (V1199M)
Ref Sequence ENSEMBL: ENSMUSP00000063066 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049845] [ENSMUST00000163139]
PDB Structure
The Plexin A1 intracellular region in complex with Rac1 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000049845
AA Change: V1199M

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000063066
Gene: ENSMUSG00000030084
AA Change: V1199M

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Sema 49 494 7.43e-126 SMART
PSI 512 562 6.4e-11 SMART
PSI 658 705 9.78e-7 SMART
low complexity region 759 772 N/A INTRINSIC
PSI 806 860 7.24e-10 SMART
IPT 861 957 3.2e-26 SMART
IPT 958 1043 1.59e-21 SMART
IPT 1045 1145 6.86e-26 SMART
IPT 1147 1242 1.64e-5 SMART
transmembrane domain 1243 1265 N/A INTRINSIC
Pfam:Plexin_cytopl 1316 1864 8.8e-263 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163139
AA Change: V1199M

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000131840
Gene: ENSMUSG00000030084
AA Change: V1199M

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Sema 49 494 7.43e-126 SMART
PSI 512 562 6.4e-11 SMART
PSI 658 705 9.78e-7 SMART
low complexity region 759 772 N/A INTRINSIC
PSI 806 860 7.24e-10 SMART
IPT 861 957 3.2e-26 SMART
IPT 958 1043 1.59e-21 SMART
IPT 1045 1145 6.86e-26 SMART
IPT 1147 1242 1.64e-5 SMART
transmembrane domain 1243 1265 N/A INTRINSIC
Pfam:Plexin_cytopl 1315 1864 2.5e-264 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205121
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit bone cellularity abnormalities, altered dendritic cell physiology, abnormal proprioceptive and oligodendrocyte morphology, and increased lymphatic branching complexity and LEC numbers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank1 A G 8: 23,117,058 D1325G probably damaging Het
Asxl1 T C 2: 153,400,652 S1042P probably damaging Het
Bpifb1 C T 2: 154,202,729 H39Y possibly damaging Het
Capn13 C A 17: 73,315,305 M663I probably damaging Het
Clec2g A G 6: 128,979,437 E72G probably damaging Het
Col12a1 T A 9: 79,651,486 Y1899F probably damaging Het
Ctbp2 A G 7: 133,014,624 V194A probably benign Het
Cttnbp2 G T 6: 18,382,810 L1320I probably damaging Het
E2f2 T A 4: 136,192,826 L374* probably null Het
Echdc3 C T 2: 6,212,876 G29S probably benign Het
Ecm1 A G 3: 95,736,182 S269P probably damaging Het
Elmo2 G A 2: 165,291,744 P775S unknown Het
Faf1 G A 4: 109,829,864 R267K probably benign Het
Fam162a G A 16: 36,049,937 probably benign Het
Fam178b T A 1: 36,564,451 D473V probably damaging Het
Fat2 G A 11: 55,282,330 T2519I probably damaging Het
Foxc2 A G 8: 121,118,095 Y494C probably damaging Het
Gcnt2 C A 13: 40,953,719 Q355K probably benign Het
Glg1 G T 8: 111,178,865 H595N probably benign Het
Gm9913 A T 2: 125,506,560 H97L unknown Het
Hbegf T A 18: 36,507,548 N152I possibly damaging Het
Hipk1 G A 3: 103,760,550 T567I probably damaging Het
Idh3a C T 9: 54,595,169 P78S probably damaging Het
Igsf10 A T 3: 59,319,340 M2304K possibly damaging Het
Inf2 A G 12: 112,606,994 T723A unknown Het
Itpr2 A T 6: 146,187,550 F2220Y probably benign Het
Kpnb1 C T 11: 97,169,173 R557Q probably damaging Het
Lefty1 A G 1: 180,936,760 D155G probably damaging Het
Lrp1 A G 10: 127,574,053 C1554R probably damaging Het
Lrrc10 A G 10: 117,045,757 D112G probably benign Het
Med12l A G 3: 59,076,720 E439G probably damaging Het
Ms4a7 A T 19: 11,324,504 F185Y probably benign Het
Mtmr6 T A 14: 60,289,652 M234K probably damaging Het
Myo1d T C 11: 80,676,893 M254V possibly damaging Het
Nbas T C 12: 13,415,661 V1368A probably damaging Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Neb A G 2: 52,206,702 V4999A probably damaging Het
Npbwr1 G T 1: 5,916,708 Q196K probably benign Het
Nsd3 A T 8: 25,659,817 E339D possibly damaging Het
Olfr738 T C 14: 50,414,014 F157L probably damaging Het
Olfr776 A G 10: 129,261,068 S36G probably damaging Het
Olfr867 T C 9: 20,054,605 N168S probably damaging Het
Oog4 CAA CA 4: 143,437,452 probably null Het
Ppfibp2 T A 7: 107,716,666 M285K probably damaging Het
Ppip5k1 A G 2: 121,337,661 Y704H probably damaging Het
Ptpn18 G A 1: 34,473,364 D417N possibly damaging Het
Sbspon T C 1: 15,859,058 M170V probably benign Het
Scfd2 A C 5: 74,458,636 F440V probably benign Het
Slc22a19 T A 19: 7,710,937 D86V possibly damaging Het
Smg5 A G 3: 88,353,895 N685S possibly damaging Het
Spata46 A G 1: 170,311,764 R111G possibly damaging Het
Sry A T Y: 2,663,248 D137E possibly damaging Het
Tbkbp1 T C 11: 97,149,483 D35G probably damaging Het
Tcf20 A T 15: 82,851,565 V1895D possibly damaging Het
Tfap4 G T 16: 4,551,766 Q112K possibly damaging Het
Tmem2 C A 19: 21,798,116 T241K probably damaging Het
Trmt10c T A 16: 56,034,939 D111V probably benign Het
Unc80 T C 1: 66,649,722 I2415T probably benign Het
Vmn2r107 A T 17: 20,356,639 M300L probably benign Het
Vmn2r5 A T 3: 64,509,522 F72I probably benign Het
Vmn2r53 T A 7: 12,598,498 H408L probably benign Het
Zan C T 5: 137,463,540 V1126M unknown Het
Zfp493 A T 13: 67,779,695 probably benign Het
Zfp618 C A 4: 63,086,621 A86E probably benign Het
Other mutations in Plxna1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Plxna1 APN 6 89320998 missense probably damaging 1.00
IGL01358:Plxna1 APN 6 89322750 missense probably damaging 1.00
IGL01475:Plxna1 APN 6 89354888 missense possibly damaging 0.92
IGL01480:Plxna1 APN 6 89344096 missense possibly damaging 0.70
IGL01585:Plxna1 APN 6 89329556 critical splice donor site probably null
IGL01804:Plxna1 APN 6 89329646 missense probably damaging 1.00
IGL01909:Plxna1 APN 6 89332084 critical splice donor site probably null
IGL01989:Plxna1 APN 6 89329414 nonsense probably null
IGL02015:Plxna1 APN 6 89342451 missense probably damaging 1.00
IGL02023:Plxna1 APN 6 89357332 missense possibly damaging 0.88
IGL02668:Plxna1 APN 6 89357269 nonsense probably null
IGL02703:Plxna1 APN 6 89356943 missense probably damaging 1.00
IGL02954:Plxna1 APN 6 89324667 missense probably damaging 1.00
IGL03212:Plxna1 APN 6 89331903 missense probably damaging 1.00
PIT4544001:Plxna1 UTSW 6 89357429 missense probably benign 0.14
R0055:Plxna1 UTSW 6 89329739 missense possibly damaging 0.94
R0055:Plxna1 UTSW 6 89329739 missense possibly damaging 0.94
R0147:Plxna1 UTSW 6 89320710 missense possibly damaging 0.95
R0149:Plxna1 UTSW 6 89320613 missense probably null 0.95
R0166:Plxna1 UTSW 6 89333019 missense probably damaging 1.00
R0200:Plxna1 UTSW 6 89323593 missense probably damaging 1.00
R0415:Plxna1 UTSW 6 89357336 missense probably benign 0.12
R0841:Plxna1 UTSW 6 89332204 missense probably damaging 1.00
R1018:Plxna1 UTSW 6 89342960 missense probably damaging 1.00
R1240:Plxna1 UTSW 6 89321050 missense probably damaging 1.00
R1355:Plxna1 UTSW 6 89320766 unclassified probably benign
R1700:Plxna1 UTSW 6 89357008 missense probably damaging 1.00
R1776:Plxna1 UTSW 6 89335464 missense probably benign 0.00
R1957:Plxna1 UTSW 6 89331291 missense probably damaging 1.00
R2314:Plxna1 UTSW 6 89324316 missense probably damaging 1.00
R2968:Plxna1 UTSW 6 89342608 missense probably damaging 1.00
R3118:Plxna1 UTSW 6 89356976 missense possibly damaging 0.89
R3522:Plxna1 UTSW 6 89337353 critical splice acceptor site probably null
R3619:Plxna1 UTSW 6 89357453 missense probably damaging 0.97
R3766:Plxna1 UTSW 6 89334775 unclassified probably benign
R3847:Plxna1 UTSW 6 89356519 missense probably damaging 1.00
R3849:Plxna1 UTSW 6 89356519 missense probably damaging 1.00
R3872:Plxna1 UTSW 6 89332692 nonsense probably null
R4555:Plxna1 UTSW 6 89323328 missense probably damaging 0.99
R4709:Plxna1 UTSW 6 89334751 missense possibly damaging 0.72
R4726:Plxna1 UTSW 6 89322816 missense probably damaging 1.00
R4739:Plxna1 UTSW 6 89332675 splice site probably null
R5053:Plxna1 UTSW 6 89322460 missense probably damaging 1.00
R5221:Plxna1 UTSW 6 89321016 missense probably damaging 1.00
R5449:Plxna1 UTSW 6 89323608 missense probably damaging 1.00
R5480:Plxna1 UTSW 6 89324634 missense probably damaging 1.00
R5575:Plxna1 UTSW 6 89324541 missense possibly damaging 0.83
R5743:Plxna1 UTSW 6 89356529 missense probably damaging 1.00
R5744:Plxna1 UTSW 6 89334682 missense possibly damaging 0.67
R5754:Plxna1 UTSW 6 89333105 missense possibly damaging 0.96
R5868:Plxna1 UTSW 6 89322722 splice site probably benign
R5988:Plxna1 UTSW 6 89357540 nonsense probably null
R6190:Plxna1 UTSW 6 89356604 nonsense probably null
R6425:Plxna1 UTSW 6 89334665 missense probably benign 0.00
R6561:Plxna1 UTSW 6 89356978 missense probably damaging 1.00
R6623:Plxna1 UTSW 6 89322771 missense probably damaging 1.00
R6638:Plxna1 UTSW 6 89324400 missense probably damaging 0.97
R6701:Plxna1 UTSW 6 89319448 missense probably damaging 0.99
R6825:Plxna1 UTSW 6 89320615 missense probably benign 0.01
R6911:Plxna1 UTSW 6 89320974 missense probably damaging 1.00
R7073:Plxna1 UTSW 6 89357329 missense probably damaging 1.00
R7177:Plxna1 UTSW 6 89323329 missense possibly damaging 0.50
R7235:Plxna1 UTSW 6 89340591 missense probably damaging 0.97
R7419:Plxna1 UTSW 6 89357602 missense unknown
R7511:Plxna1 UTSW 6 89341907 missense possibly damaging 0.71
R7543:Plxna1 UTSW 6 89322855 missense probably damaging 1.00
R7665:Plxna1 UTSW 6 89324538 critical splice donor site probably null
R7748:Plxna1 UTSW 6 89337352 critical splice acceptor site probably null
R7748:Plxna1 UTSW 6 89337353 critical splice acceptor site probably null
S24628:Plxna1 UTSW 6 89357336 missense probably benign 0.12
V8831:Plxna1 UTSW 6 89357137 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCTCCATGGGGATTTTCTCAGAG -3'
(R):5'- GCTCATCCTCAAGGTAGGTCTC -3'

Sequencing Primer
(F):5'- CTCAGAGGTGGGGTTGCTCTAG -3'
(R):5'- TCAAGGTAGGTCTCAGCCACTG -3'
Posted On2019-11-12