Incidental Mutation 'R7678:Ppfibp2'
ID592581
Institutional Source Beutler Lab
Gene Symbol Ppfibp2
Ensembl Gene ENSMUSG00000036528
Gene NamePTPRF interacting protein, binding protein 2 (liprin beta 2)
SynonymsCclp1, liprin beta 2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7678 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location107595207-107748583 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 107716666 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 285 (M285K)
Ref Sequence ENSEMBL: ENSMUSP00000095738 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040056] [ENSMUST00000098134]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040056
AA Change: M285K

PolyPhen 2 Score 0.730 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000042574
Gene: ENSMUSG00000036528
AA Change: M285K

DomainStartEndE-ValueType
Pfam:Integrase_DNA 192 256 3.4e-24 PFAM
low complexity region 357 374 N/A INTRINSIC
SAM 561 628 1.86e-12 SMART
SAM 633 699 4.07e-9 SMART
SAM 721 793 9.22e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000098134
AA Change: M285K

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000095738
Gene: ENSMUSG00000036528
AA Change: M285K

DomainStartEndE-ValueType
PDB:3QH9|A 185 265 2e-26 PDB
low complexity region 357 374 N/A INTRINSIC
SAM 550 617 1.86e-12 SMART
SAM 622 688 4.07e-9 SMART
SAM 710 782 9.22e-8 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the LAR protein-tyrosine phosphatase-interacting protein (liprin) family. The encoded protein is a beta liprin and plays a role in axon guidance and neuronal synapse development by recruiting LAR protein-tyrosine phosphatases to the plasma membrane. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2012]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam22 C A 5: 8,087,750 probably null Het
Ank1 A G 8: 23,117,058 D1325G probably damaging Het
Asxl1 T C 2: 153,400,652 S1042P probably damaging Het
Bpifb1 C T 2: 154,202,729 H39Y possibly damaging Het
Capn13 C A 17: 73,315,305 M663I probably damaging Het
Clec2g A G 6: 128,979,437 E72G probably damaging Het
Col12a1 T A 9: 79,651,486 Y1899F probably damaging Het
Ctbp2 A G 7: 133,014,624 V194A probably benign Het
Cttnbp2 G T 6: 18,382,810 L1320I probably damaging Het
E2f2 T A 4: 136,192,826 L374* probably null Het
Echdc3 C T 2: 6,212,876 G29S probably benign Het
Ecm1 A G 3: 95,736,182 S269P probably damaging Het
Elmo2 G A 2: 165,291,744 P775S unknown Het
Eno3 T A 11: 70,659,167 probably null Het
Faf1 G A 4: 109,829,864 R267K probably benign Het
Fam162a G A 16: 36,049,937 probably benign Het
Fam178b T A 1: 36,564,451 D473V probably damaging Het
Fat2 G A 11: 55,282,330 T2519I probably damaging Het
Foxc2 A G 8: 121,118,095 Y494C probably damaging Het
Gcnt2 C A 13: 40,953,719 Q355K probably benign Het
Glg1 G T 8: 111,178,865 H595N probably benign Het
Gm9913 A T 2: 125,506,560 H97L unknown Het
Hbegf T A 18: 36,507,548 N152I possibly damaging Het
Hipk1 G A 3: 103,760,550 T567I probably damaging Het
Idh3a C T 9: 54,595,169 P78S probably damaging Het
Igsf10 A T 3: 59,319,340 M2304K possibly damaging Het
Inf2 A G 12: 112,606,994 T723A unknown Het
Itpr2 A T 6: 146,187,550 F2220Y probably benign Het
Kpnb1 C T 11: 97,169,173 R557Q probably damaging Het
Lefty1 A G 1: 180,936,760 D155G probably damaging Het
Lrp1 A G 10: 127,574,053 C1554R probably damaging Het
Lrrc10 A G 10: 117,045,757 D112G probably benign Het
Med12l A G 3: 59,076,720 E439G probably damaging Het
Ms4a7 A T 19: 11,324,504 F185Y probably benign Het
Mtmr6 T A 14: 60,289,652 M234K probably damaging Het
Myh7b C A 2: 155,617,778 probably null Het
Myo1d T C 11: 80,676,893 M254V possibly damaging Het
Nbas T C 12: 13,415,661 V1368A probably damaging Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Neb A G 2: 52,206,702 V4999A probably damaging Het
Npbwr1 G T 1: 5,916,708 Q196K probably benign Het
Nsd3 A T 8: 25,659,817 E339D possibly damaging Het
Olfr738 T C 14: 50,414,014 F157L probably damaging Het
Olfr776 A G 10: 129,261,068 S36G probably damaging Het
Olfr867 T C 9: 20,054,605 N168S probably damaging Het
Oog4 CAA CA 4: 143,437,452 probably null Het
Plxna1 C T 6: 89,331,900 V1199M probably damaging Het
Ppip5k1 A G 2: 121,337,661 Y704H probably damaging Het
Ptpn18 G A 1: 34,473,364 D417N possibly damaging Het
Sbspon T C 1: 15,859,058 M170V probably benign Het
Scfd2 A C 5: 74,458,636 F440V probably benign Het
Slc22a19 T A 19: 7,710,937 D86V possibly damaging Het
Smg5 A G 3: 88,353,895 N685S possibly damaging Het
Spata46 A G 1: 170,311,764 R111G possibly damaging Het
Sry A T Y: 2,663,248 D137E possibly damaging Het
Tbkbp1 T C 11: 97,149,483 D35G probably damaging Het
Tcf20 A T 15: 82,851,565 V1895D possibly damaging Het
Tfap4 G T 16: 4,551,766 Q112K possibly damaging Het
Tmem2 C A 19: 21,798,116 T241K probably damaging Het
Trmt10c T A 16: 56,034,939 D111V probably benign Het
Unc80 T C 1: 66,649,722 I2415T probably benign Het
Vmn2r107 A T 17: 20,356,639 M300L probably benign Het
Vmn2r5 A T 3: 64,509,522 F72I probably benign Het
Vmn2r53 T A 7: 12,598,498 H408L probably benign Het
Zan C T 5: 137,463,540 V1126M unknown Het
Zfp493 A T 13: 67,779,695 probably benign Het
Zfp618 C A 4: 63,086,621 A86E probably benign Het
Other mutations in Ppfibp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00426:Ppfibp2 APN 7 107708805 missense probably damaging 1.00
IGL00429:Ppfibp2 APN 7 107697594 missense probably benign 0.18
IGL00785:Ppfibp2 APN 7 107737887 missense probably benign
IGL00821:Ppfibp2 APN 7 107729876 missense probably damaging 1.00
IGL01295:Ppfibp2 APN 7 107747539 unclassified probably benign
IGL01361:Ppfibp2 APN 7 107744301 splice site probably null
IGL02115:Ppfibp2 APN 7 107739318 unclassified probably benign
IGL02323:Ppfibp2 APN 7 107738629 missense probably damaging 1.00
IGL02458:Ppfibp2 APN 7 107742964 missense probably damaging 1.00
IGL02731:Ppfibp2 APN 7 107746422 missense possibly damaging 0.92
IGL03343:Ppfibp2 APN 7 107737919 nonsense probably null
R0142:Ppfibp2 UTSW 7 107744177 missense probably damaging 1.00
R0555:Ppfibp2 UTSW 7 107729174 missense probably damaging 1.00
R0630:Ppfibp2 UTSW 7 107738599 critical splice acceptor site probably null
R1374:Ppfibp2 UTSW 7 107685988 splice site probably benign
R1668:Ppfibp2 UTSW 7 107729892 missense probably damaging 1.00
R1731:Ppfibp2 UTSW 7 107740589 missense probably damaging 1.00
R1830:Ppfibp2 UTSW 7 107637297 missense probably damaging 1.00
R1902:Ppfibp2 UTSW 7 107746378 missense probably damaging 1.00
R2061:Ppfibp2 UTSW 7 107739230 missense probably damaging 1.00
R2929:Ppfibp2 UTSW 7 107697651 missense probably damaging 0.99
R3777:Ppfibp2 UTSW 7 107729189 missense probably benign 0.00
R3778:Ppfibp2 UTSW 7 107729189 missense probably benign 0.00
R4839:Ppfibp2 UTSW 7 107742985 missense probably damaging 1.00
R4879:Ppfibp2 UTSW 7 107729183 missense probably benign 0.01
R5643:Ppfibp2 UTSW 7 107737890 missense probably damaging 1.00
R5773:Ppfibp2 UTSW 7 107685872 missense possibly damaging 0.74
R6255:Ppfibp2 UTSW 7 107681762 missense probably damaging 0.96
R6356:Ppfibp2 UTSW 7 107681769 missense probably benign 0.01
R6843:Ppfibp2 UTSW 7 107727731 missense probably benign 0.00
R6889:Ppfibp2 UTSW 7 107737981 missense possibly damaging 0.94
R7051:Ppfibp2 UTSW 7 107717718 missense probably damaging 1.00
R7194:Ppfibp2 UTSW 7 107722980 critical splice donor site probably null
R7654:Ppfibp2 UTSW 7 107738611 missense probably damaging 0.99
R7895:Ppfibp2 UTSW 7 107721317 splice site probably null
R8385:Ppfibp2 UTSW 7 107697687 missense probably benign 0.44
R8434:Ppfibp2 UTSW 7 107728750 critical splice donor site probably null
RF022:Ppfibp2 UTSW 7 107697610 missense probably damaging 1.00
Z1177:Ppfibp2 UTSW 7 107743050 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- GTCTAATGAGACCCACGGTG -3'
(R):5'- GCTCTAAGTCACATTTGAGAGATTC -3'

Sequencing Primer
(F):5'- ACGGTGCCAGATACCATCCTG -3'
(R):5'- AAGTTGAGTCTCTAGTGCCAAAAGC -3'
Posted On2019-11-12