Incidental Mutation 'R7678:Ctbp2'
ID592582
Institutional Source Beutler Lab
Gene Symbol Ctbp2
Ensembl Gene ENSMUSG00000030970
Gene NameC-terminal binding protein 2
SynonymsD7Ertd45e, Gtrgeo6, Ribeye
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7678 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location132987563-133124354 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 133014624 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 194 (V194A)
Ref Sequence ENSEMBL: ENSMUSP00000130294 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033269] [ENSMUST00000124096] [ENSMUST00000163601] [ENSMUST00000165457] [ENSMUST00000166439] [ENSMUST00000167218] [ENSMUST00000168958] [ENSMUST00000169570] [ENSMUST00000170459] [ENSMUST00000172341]
Predicted Effect probably benign
Transcript: ENSMUST00000033269
SMART Domains Protein: ENSMUSP00000033269
Gene: ENSMUSG00000030970

DomainStartEndE-ValueType
Pfam:2-Hacid_dh 36 358 2.9e-31 PFAM
Pfam:2-Hacid_dh_C 139 323 1.7e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163601
Predicted Effect probably benign
Transcript: ENSMUST00000165457
Predicted Effect probably benign
Transcript: ENSMUST00000166439
SMART Domains Protein: ENSMUSP00000127448
Gene: ENSMUSG00000030970

DomainStartEndE-ValueType
Pfam:2-Hacid_dh 11 333 2.4e-31 PFAM
Pfam:2-Hacid_dh_C 114 298 1.5e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167218
Predicted Effect probably benign
Transcript: ENSMUST00000168958
SMART Domains Protein: ENSMUSP00000132892
Gene: ENSMUSG00000030970

DomainStartEndE-ValueType
Pfam:2-Hacid_dh 19 164 6.3e-27 PFAM
Pfam:2-Hacid_dh_C 122 188 8.5e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169570
AA Change: V194A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000130294
Gene: ENSMUSG00000030970
AA Change: V194A

DomainStartEndE-ValueType
Pfam:2-Hacid_dh 579 901 2.8e-31 PFAM
Pfam:2-Hacid_dh_C 682 866 5.6e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170459
Predicted Effect probably benign
Transcript: ENSMUST00000172341
SMART Domains Protein: ENSMUSP00000127701
Gene: ENSMUSG00000030970

DomainStartEndE-ValueType
Pfam:2-Hacid_dh 36 177 5.6e-27 PFAM
Meta Mutation Damage Score 0.0603 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene produces alternative transcripts encoding two distinct proteins. One protein is a transcriptional repressor, while the other isoform is a major component of specialized synapses known as synaptic ribbons. Both proteins contain a NAD+ binding domain similar to NAD+-dependent 2-hydroxyacid dehydrogenases. A portion of the 3' untranslated region was used to map this gene to chromosome 21q21.3; however, it was noted that similar loci elsewhere in the genome are likely. Blast analysis shows that this gene is present on chromosome 10. Several transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Feb 2014]
PHENOTYPE: Embryos homozygous for a gene-trapped allele die by E10 exhibiting a small size, axial truncations, a thin neural epithelium, a dilated pericardium, delayed fore- and midbrain development, and defects in heart morphogenesis, placental development and extraembryonic vascularization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam22 C A 5: 8,087,750 probably null Het
Ank1 A G 8: 23,117,058 D1325G probably damaging Het
Asxl1 T C 2: 153,400,652 S1042P probably damaging Het
Bpifb1 C T 2: 154,202,729 H39Y possibly damaging Het
Capn13 C A 17: 73,315,305 M663I probably damaging Het
Clec2g A G 6: 128,979,437 E72G probably damaging Het
Col12a1 T A 9: 79,651,486 Y1899F probably damaging Het
Cttnbp2 G T 6: 18,382,810 L1320I probably damaging Het
E2f2 T A 4: 136,192,826 L374* probably null Het
Echdc3 C T 2: 6,212,876 G29S probably benign Het
Ecm1 A G 3: 95,736,182 S269P probably damaging Het
Elmo2 G A 2: 165,291,744 P775S unknown Het
Eno3 T A 11: 70,659,167 probably null Het
Faf1 G A 4: 109,829,864 R267K probably benign Het
Fam162a G A 16: 36,049,937 probably benign Het
Fam178b T A 1: 36,564,451 D473V probably damaging Het
Fat2 G A 11: 55,282,330 T2519I probably damaging Het
Foxc2 A G 8: 121,118,095 Y494C probably damaging Het
Gcnt2 C A 13: 40,953,719 Q355K probably benign Het
Glg1 G T 8: 111,178,865 H595N probably benign Het
Gm9913 A T 2: 125,506,560 H97L unknown Het
Hbegf T A 18: 36,507,548 N152I possibly damaging Het
Hipk1 G A 3: 103,760,550 T567I probably damaging Het
Idh3a C T 9: 54,595,169 P78S probably damaging Het
Igsf10 A T 3: 59,319,340 M2304K possibly damaging Het
Inf2 A G 12: 112,606,994 T723A unknown Het
Itpr2 A T 6: 146,187,550 F2220Y probably benign Het
Kpnb1 C T 11: 97,169,173 R557Q probably damaging Het
Lefty1 A G 1: 180,936,760 D155G probably damaging Het
Lrp1 A G 10: 127,574,053 C1554R probably damaging Het
Lrrc10 A G 10: 117,045,757 D112G probably benign Het
Med12l A G 3: 59,076,720 E439G probably damaging Het
Ms4a7 A T 19: 11,324,504 F185Y probably benign Het
Mtmr6 T A 14: 60,289,652 M234K probably damaging Het
Myh7b C A 2: 155,617,778 probably null Het
Myo1d T C 11: 80,676,893 M254V possibly damaging Het
Nbas T C 12: 13,415,661 V1368A probably damaging Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Neb A G 2: 52,206,702 V4999A probably damaging Het
Npbwr1 G T 1: 5,916,708 Q196K probably benign Het
Nsd3 A T 8: 25,659,817 E339D possibly damaging Het
Olfr738 T C 14: 50,414,014 F157L probably damaging Het
Olfr776 A G 10: 129,261,068 S36G probably damaging Het
Olfr867 T C 9: 20,054,605 N168S probably damaging Het
Oog4 CAA CA 4: 143,437,452 probably null Het
Plxna1 C T 6: 89,331,900 V1199M probably damaging Het
Ppfibp2 T A 7: 107,716,666 M285K probably damaging Het
Ppip5k1 A G 2: 121,337,661 Y704H probably damaging Het
Ptpn18 G A 1: 34,473,364 D417N possibly damaging Het
Sbspon T C 1: 15,859,058 M170V probably benign Het
Scfd2 A C 5: 74,458,636 F440V probably benign Het
Slc22a19 T A 19: 7,710,937 D86V possibly damaging Het
Smg5 A G 3: 88,353,895 N685S possibly damaging Het
Spata46 A G 1: 170,311,764 R111G possibly damaging Het
Sry A T Y: 2,663,248 D137E possibly damaging Het
Tbkbp1 T C 11: 97,149,483 D35G probably damaging Het
Tcf20 A T 15: 82,851,565 V1895D possibly damaging Het
Tfap4 G T 16: 4,551,766 Q112K possibly damaging Het
Tmem2 C A 19: 21,798,116 T241K probably damaging Het
Trmt10c T A 16: 56,034,939 D111V probably benign Het
Unc80 T C 1: 66,649,722 I2415T probably benign Het
Vmn2r107 A T 17: 20,356,639 M300L probably benign Het
Vmn2r5 A T 3: 64,509,522 F72I probably benign Het
Vmn2r53 T A 7: 12,598,498 H408L probably benign Het
Zan C T 5: 137,463,540 V1126M unknown Het
Zfp493 A T 13: 67,779,695 probably benign Het
Zfp618 C A 4: 63,086,621 A86E probably benign Het
Other mutations in Ctbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02143:Ctbp2 APN 7 132991156 missense probably damaging 0.98
IGL02615:Ctbp2 APN 7 132995347 missense probably benign 0.34
IGL02626:Ctbp2 APN 7 132999211 missense probably benign 0.12
PIT4802001:Ctbp2 UTSW 7 132988245 missense possibly damaging 0.77
R0068:Ctbp2 UTSW 7 132990059 missense possibly damaging 0.95
R0374:Ctbp2 UTSW 7 132999344 missense possibly damaging 0.89
R0566:Ctbp2 UTSW 7 132991147 missense probably damaging 1.00
R0571:Ctbp2 UTSW 7 133014805 missense probably damaging 1.00
R1247:Ctbp2 UTSW 7 132995189 missense probably benign 0.24
R1292:Ctbp2 UTSW 7 133015189 missense probably damaging 1.00
R1477:Ctbp2 UTSW 7 132998941 missense probably damaging 1.00
R1732:Ctbp2 UTSW 7 132998924 missense possibly damaging 0.80
R1807:Ctbp2 UTSW 7 133014408 missense probably benign 0.00
R1865:Ctbp2 UTSW 7 132990554 missense probably benign 0.02
R1951:Ctbp2 UTSW 7 133015027 missense probably benign
R2393:Ctbp2 UTSW 7 133023561 critical splice donor site probably null
R2410:Ctbp2 UTSW 7 133014354 missense probably benign 0.08
R3427:Ctbp2 UTSW 7 132991592 missense probably damaging 1.00
R4004:Ctbp2 UTSW 7 132991773 missense probably benign 0.31
R4243:Ctbp2 UTSW 7 132998854 missense probably benign 0.43
R4754:Ctbp2 UTSW 7 133023558 splice site probably null
R4820:Ctbp2 UTSW 7 133013694 missense probably damaging 0.98
R4947:Ctbp2 UTSW 7 132999283 missense probably damaging 1.00
R4960:Ctbp2 UTSW 7 133014238 missense probably benign 0.00
R4999:Ctbp2 UTSW 7 133014649 missense possibly damaging 0.62
R5340:Ctbp2 UTSW 7 133013963 missense probably benign 0.43
R5593:Ctbp2 UTSW 7 132998869 missense possibly damaging 0.95
R5762:Ctbp2 UTSW 7 132995359 missense probably damaging 1.00
R6913:Ctbp2 UTSW 7 133014726 missense possibly damaging 0.94
R7044:Ctbp2 UTSW 7 133015102 missense possibly damaging 0.71
R7342:Ctbp2 UTSW 7 133014312 missense probably damaging 0.99
R7358:Ctbp2 UTSW 7 132998881 missense probably damaging 1.00
R7376:Ctbp2 UTSW 7 133013968 missense possibly damaging 0.93
R7393:Ctbp2 UTSW 7 132988292 missense probably benign 0.17
R7709:Ctbp2 UTSW 7 132990060 missense probably benign
R7900:Ctbp2 UTSW 7 133014599 missense probably benign
R8018:Ctbp2 UTSW 7 133014366 missense probably benign 0.38
Z1176:Ctbp2 UTSW 7 133015290 intron probably benign
Predicted Primers PCR Primer
(F):5'- CCAGCTTTGAATGGATGCTTTC -3'
(R):5'- AGCTACGGAATGCTTGGCAG -3'

Sequencing Primer
(F):5'- ATGCTTTCTCGGGTAGGCC -3'
(R):5'- GCTTGGCAGCAGAATGC -3'
Posted On2019-11-12