Incidental Mutation 'R7678:Nsd3'
ID592584
Institutional Source Beutler Lab
Gene Symbol Nsd3
Ensembl Gene ENSMUSG00000054823
Gene Namenuclear receptor binding SET domain protein 3
SynonymsWhsc1l1, WHISTLE
MMRRC Submission
Accession Numbers

Genbank: NM_001081269, NM_001001735.1; MGI: 2142581; Ensemb: ENSMUST00000155861, ENSMUST00000146919, ENSMUST00000142395, ENSMUST00000139966, ENSMUST00000153597, ENSMUST00000084026, ENSMUST0000017135

Is this an essential gene? Probably non essential (E-score: 0.239) question?
Stock #R7678 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location25601601-25719667 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 25659817 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 339 (E339D)
Ref Sequence ENSEMBL: ENSMUSP00000117596 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084026] [ENSMUST00000136107] [ENSMUST00000139966] [ENSMUST00000142395] [ENSMUST00000143445] [ENSMUST00000146919] [ENSMUST00000155861]
Predicted Effect probably damaging
Transcript: ENSMUST00000084026
AA Change: E339D

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000081040
Gene: ENSMUSG00000054823
AA Change: E339D

DomainStartEndE-ValueType
low complexity region 128 151 N/A INTRINSIC
low complexity region 193 225 N/A INTRINSIC
PWWP 278 341 1.6e-12 SMART
low complexity region 680 701 N/A INTRINSIC
PHD 713 756 4.49e-7 SMART
PHD 761 808 5.82e-1 SMART
PHD 809 861 3.06e0 SMART
PHD 874 963 1e-4 SMART
PWWP 968 1030 8.62e-18 SMART
AWS 1103 1154 2.61e-17 SMART
SET 1155 1278 2.17e-41 SMART
PostSET 1279 1295 2.63e-3 SMART
low complexity region 1309 1326 N/A INTRINSIC
PHD 1332 1375 4.32e-9 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000136107
AA Change: E339D

PolyPhen 2 Score 0.894 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect probably damaging
Transcript: ENSMUST00000139966
AA Change: E339D

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000122096
Gene: ENSMUSG00000054823
AA Change: E339D

DomainStartEndE-ValueType
low complexity region 128 151 N/A INTRINSIC
low complexity region 193 225 N/A INTRINSIC
PWWP 278 341 1.6e-12 SMART
low complexity region 680 701 N/A INTRINSIC
PHD 713 756 4.49e-7 SMART
PHD 761 808 5.82e-1 SMART
PHD 809 861 3.06e0 SMART
PHD 874 914 5.24e-8 SMART
PWWP 919 981 8.62e-18 SMART
AWS 1054 1105 2.61e-17 SMART
SET 1106 1229 2.17e-41 SMART
PostSET 1230 1246 2.63e-3 SMART
low complexity region 1260 1277 N/A INTRINSIC
PHD 1283 1326 4.32e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000142395
AA Change: E339D

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000117778
Gene: ENSMUSG00000054823
AA Change: E339D

DomainStartEndE-ValueType
low complexity region 128 151 N/A INTRINSIC
low complexity region 193 225 N/A INTRINSIC
PWWP 278 341 1.6e-12 SMART
low complexity region 680 701 N/A INTRINSIC
PHD 713 756 4.49e-7 SMART
PHD 761 808 5.82e-1 SMART
PHD 809 861 3.06e0 SMART
PHD 874 963 1e-4 SMART
PWWP 968 1030 8.62e-18 SMART
AWS 1103 1154 2.61e-17 SMART
SET 1155 1278 2.17e-41 SMART
PostSET 1279 1295 2.63e-3 SMART
low complexity region 1309 1326 N/A INTRINSIC
PHD 1332 1375 4.32e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000143445
AA Change: E339D

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect possibly damaging
Transcript: ENSMUST00000146919
AA Change: E339D

PolyPhen 2 Score 0.818 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000115470
Gene: ENSMUSG00000054823
AA Change: E339D

DomainStartEndE-ValueType
low complexity region 128 151 N/A INTRINSIC
low complexity region 193 225 N/A INTRINSIC
Pfam:PWWP 278 388 1.6e-25 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000155861
AA Change: E339D

PolyPhen 2 Score 0.818 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000117596
Gene: ENSMUSG00000054823
AA Change: E339D

DomainStartEndE-ValueType
low complexity region 128 151 N/A INTRINSIC
low complexity region 193 225 N/A INTRINSIC
Pfam:PWWP 278 388 1.6e-25 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: This gene encodes a member of the SET domain family of histone lysine N-methyltransferase proteins. This protein methylates histone H3 at lysine residues 4 and 27, which represses gene transcription. It acts in opposition to the histone demethylase Jmjd1c. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2015]
Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam22 C A 5: 8,087,750 probably null Het
Ank1 A G 8: 23,117,058 D1325G probably damaging Het
Asxl1 T C 2: 153,400,652 S1042P probably damaging Het
Bpifb1 C T 2: 154,202,729 H39Y possibly damaging Het
Capn13 C A 17: 73,315,305 M663I probably damaging Het
Clec2g A G 6: 128,979,437 E72G probably damaging Het
Col12a1 T A 9: 79,651,486 Y1899F probably damaging Het
Ctbp2 A G 7: 133,014,624 V194A probably benign Het
Cttnbp2 G T 6: 18,382,810 L1320I probably damaging Het
E2f2 T A 4: 136,192,826 L374* probably null Het
Echdc3 C T 2: 6,212,876 G29S probably benign Het
Ecm1 A G 3: 95,736,182 S269P probably damaging Het
Elmo2 G A 2: 165,291,744 P775S unknown Het
Eno3 T A 11: 70,659,167 probably null Het
Faf1 G A 4: 109,829,864 R267K probably benign Het
Fam162a G A 16: 36,049,937 probably benign Het
Fam178b T A 1: 36,564,451 D473V probably damaging Het
Fat2 G A 11: 55,282,330 T2519I probably damaging Het
Foxc2 A G 8: 121,118,095 Y494C probably damaging Het
Gcnt2 C A 13: 40,953,719 Q355K probably benign Het
Glg1 G T 8: 111,178,865 H595N probably benign Het
Gm9913 A T 2: 125,506,560 H97L unknown Het
Hbegf T A 18: 36,507,548 N152I possibly damaging Het
Hipk1 G A 3: 103,760,550 T567I probably damaging Het
Idh3a C T 9: 54,595,169 P78S probably damaging Het
Igsf10 A T 3: 59,319,340 M2304K possibly damaging Het
Inf2 A G 12: 112,606,994 T723A unknown Het
Itpr2 A T 6: 146,187,550 F2220Y probably benign Het
Kpnb1 C T 11: 97,169,173 R557Q probably damaging Het
Lefty1 A G 1: 180,936,760 D155G probably damaging Het
Lrp1 A G 10: 127,574,053 C1554R probably damaging Het
Lrrc10 A G 10: 117,045,757 D112G probably benign Het
Med12l A G 3: 59,076,720 E439G probably damaging Het
Ms4a7 A T 19: 11,324,504 F185Y probably benign Het
Mtmr6 T A 14: 60,289,652 M234K probably damaging Het
Myh7b C A 2: 155,617,778 probably null Het
Myo1d T C 11: 80,676,893 M254V possibly damaging Het
Nbas T C 12: 13,415,661 V1368A probably damaging Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Neb A G 2: 52,206,702 V4999A probably damaging Het
Npbwr1 G T 1: 5,916,708 Q196K probably benign Het
Olfr738 T C 14: 50,414,014 F157L probably damaging Het
Olfr776 A G 10: 129,261,068 S36G probably damaging Het
Olfr867 T C 9: 20,054,605 N168S probably damaging Het
Oog4 CAA CA 4: 143,437,452 probably null Het
Plxna1 C T 6: 89,331,900 V1199M probably damaging Het
Ppfibp2 T A 7: 107,716,666 M285K probably damaging Het
Ppip5k1 A G 2: 121,337,661 Y704H probably damaging Het
Ptpn18 G A 1: 34,473,364 D417N possibly damaging Het
Sbspon T C 1: 15,859,058 M170V probably benign Het
Scfd2 A C 5: 74,458,636 F440V probably benign Het
Slc22a19 T A 19: 7,710,937 D86V possibly damaging Het
Smg5 A G 3: 88,353,895 N685S possibly damaging Het
Spata46 A G 1: 170,311,764 R111G possibly damaging Het
Sry A T Y: 2,663,248 D137E possibly damaging Het
Tbkbp1 T C 11: 97,149,483 D35G probably damaging Het
Tcf20 A T 15: 82,851,565 V1895D possibly damaging Het
Tfap4 G T 16: 4,551,766 Q112K possibly damaging Het
Tmem2 C A 19: 21,798,116 T241K probably damaging Het
Trmt10c T A 16: 56,034,939 D111V probably benign Het
Unc80 T C 1: 66,649,722 I2415T probably benign Het
Vmn2r107 A T 17: 20,356,639 M300L probably benign Het
Vmn2r5 A T 3: 64,509,522 F72I probably benign Het
Vmn2r53 T A 7: 12,598,498 H408L probably benign Het
Zan C T 5: 137,463,540 V1126M unknown Het
Zfp493 A T 13: 67,779,695 probably benign Het
Zfp618 C A 4: 63,086,621 A86E probably benign Het
Other mutations in Nsd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Nsd3 APN 8 25676712 missense probably benign 0.40
IGL00718:Nsd3 APN 8 25706534 missense probably damaging 0.97
IGL00727:Nsd3 APN 8 25641158 missense probably damaging 1.00
IGL01324:Nsd3 APN 8 25662820 missense probably damaging 1.00
IGL01614:Nsd3 APN 8 25666079 missense possibly damaging 0.65
IGL01834:Nsd3 APN 8 25640652 missense probably damaging 1.00
IGL02066:Nsd3 APN 8 25713488 missense probably damaging 1.00
IGL02229:Nsd3 APN 8 25710748 missense probably damaging 0.98
IGL02481:Nsd3 APN 8 25691116 missense probably damaging 1.00
IGL02686:Nsd3 APN 8 25666070 missense probably damaging 0.96
IGL03394:Nsd3 APN 8 25675749 splice site probably benign
Pine UTSW 8 25679936 missense possibly damaging 0.87
D3080:Nsd3 UTSW 8 25713545 missense possibly damaging 0.77
IGL02802:Nsd3 UTSW 8 25640906 missense probably damaging 1.00
R0136:Nsd3 UTSW 8 25659854 nonsense probably null
R0195:Nsd3 UTSW 8 25680693 missense probably damaging 1.00
R0207:Nsd3 UTSW 8 25683257 missense probably benign 0.02
R0471:Nsd3 UTSW 8 25648434 splice site probably benign
R0511:Nsd3 UTSW 8 25678716 missense possibly damaging 0.81
R0524:Nsd3 UTSW 8 25700577 missense possibly damaging 0.90
R0581:Nsd3 UTSW 8 25710691 missense probably damaging 1.00
R0589:Nsd3 UTSW 8 25641287 missense probably damaging 1.00
R0645:Nsd3 UTSW 8 25709069 missense probably benign 0.08
R0664:Nsd3 UTSW 8 25714240 missense probably damaging 0.97
R0738:Nsd3 UTSW 8 25678709 splice site probably null
R1148:Nsd3 UTSW 8 25713380 missense probably benign 0.09
R1148:Nsd3 UTSW 8 25713380 missense probably benign 0.09
R1265:Nsd3 UTSW 8 25682562 missense probably benign
R1298:Nsd3 UTSW 8 25679936 missense possibly damaging 0.87
R1424:Nsd3 UTSW 8 25700566 missense probably damaging 1.00
R1493:Nsd3 UTSW 8 25713380 missense probably benign 0.09
R1528:Nsd3 UTSW 8 25698767 missense probably damaging 1.00
R2051:Nsd3 UTSW 8 25691089 missense probably damaging 0.99
R2199:Nsd3 UTSW 8 25666057 missense probably damaging 0.99
R3414:Nsd3 UTSW 8 25700019 missense probably damaging 1.00
R3522:Nsd3 UTSW 8 25706614 missense probably benign
R3623:Nsd3 UTSW 8 25662819 missense probably damaging 0.98
R3624:Nsd3 UTSW 8 25662819 missense probably damaging 0.98
R3798:Nsd3 UTSW 8 25698845 missense probably damaging 1.00
R4345:Nsd3 UTSW 8 25641317 missense probably benign 0.04
R4370:Nsd3 UTSW 8 25648508 missense probably benign 0.13
R4421:Nsd3 UTSW 8 25641272 missense probably damaging 0.99
R4583:Nsd3 UTSW 8 25710676 missense probably benign 0.20
R4664:Nsd3 UTSW 8 25698866 missense probably damaging 1.00
R4741:Nsd3 UTSW 8 25673366 missense probably damaging 1.00
R4876:Nsd3 UTSW 8 25691134 missense possibly damaging 0.94
R4888:Nsd3 UTSW 8 25698911 missense probably damaging 1.00
R5000:Nsd3 UTSW 8 25682577 missense probably damaging 1.00
R5132:Nsd3 UTSW 8 25678839 missense possibly damaging 0.73
R5632:Nsd3 UTSW 8 25679969 missense probably benign 0.00
R5760:Nsd3 UTSW 8 25659756 missense probably damaging 1.00
R5778:Nsd3 UTSW 8 25659818 missense probably damaging 1.00
R5779:Nsd3 UTSW 8 25682669 nonsense probably null
R5860:Nsd3 UTSW 8 25666091 missense probably damaging 0.98
R5911:Nsd3 UTSW 8 25666076 missense probably damaging 1.00
R6168:Nsd3 UTSW 8 25691161 missense probably null 1.00
R6467:Nsd3 UTSW 8 25640630 missense probably damaging 1.00
R6490:Nsd3 UTSW 8 25714185 missense probably damaging 1.00
R6519:Nsd3 UTSW 8 25662939 missense probably damaging 1.00
R6554:Nsd3 UTSW 8 25662875 missense probably damaging 0.99
R7038:Nsd3 UTSW 8 25641263 missense probably damaging 1.00
R7088:Nsd3 UTSW 8 25666034 missense probably benign 0.40
R7244:Nsd3 UTSW 8 25666039 missense probably damaging 0.96
R7308:Nsd3 UTSW 8 25640724 missense probably damaging 1.00
R7717:Nsd3 UTSW 8 25682562 missense probably benign
R8064:Nsd3 UTSW 8 25700670 nonsense probably null
X0026:Nsd3 UTSW 8 25700593 missense probably damaging 1.00
Z1088:Nsd3 UTSW 8 25641002 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- GAATGATTTGATCAGTGTTTGCCTC -3'
(R):5'- TCTTGGCAGTACTACAATGTTGC -3'

Sequencing Primer
(F):5'- GATCAGTGTTTGCCTCTTAAAAGTTC -3'
(R):5'- GGCCTGGAACTTGCTATATACAGC -3'
Posted On2019-11-12