Incidental Mutation 'R7678:Inf2'
ID592598
Institutional Source Beutler Lab
Gene Symbol Inf2
Ensembl Gene ENSMUSG00000037679
Gene Nameinverted formin, FH2 and WH2 domain containing
Synonyms2610204M08Rik, EG629699
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7678 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location112588784-112615557 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 112606994 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 723 (T723A)
Ref Sequence ENSEMBL: ENSMUSP00000098591 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101029]
Predicted Effect unknown
Transcript: ENSMUST00000101029
AA Change: T723A
SMART Domains Protein: ENSMUSP00000098591
Gene: ENSMUSG00000037679
AA Change: T723A

DomainStartEndE-ValueType
Drf_GBD 1 152 3.47e-34 SMART
Drf_FH3 156 343 2.18e-58 SMART
low complexity region 359 382 N/A INTRINSIC
low complexity region 420 518 N/A INTRINSIC
low complexity region 525 557 N/A INTRINSIC
FH2 587 1030 1.96e-53 SMART
WH2 1005 1020 1.68e-2 SMART
Blast:FH2 1049 1179 3e-28 BLAST
Predicted Effect
Meta Mutation Damage Score 0.1801 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene represents a member of the formin family of proteins. It is considered a diaphanous formin due to the presence of a diaphanous inhibitory domain located at the N-terminus of the encoded protein. Studies of a similar mouse protein indicate that the protein encoded by this locus may function in polymerization and depolymerization of actin filaments. Mutations at this locus have been associated with focal segmental glomerulosclerosis 5.[provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a null allele display placental vasculopathy, restricted fetal growth, increased gestational length and transient increase in maternal blood pressure in the late stages of pregnancy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam22 C A 5: 8,087,750 probably null Het
Ank1 A G 8: 23,117,058 D1325G probably damaging Het
Asxl1 T C 2: 153,400,652 S1042P probably damaging Het
Bpifb1 C T 2: 154,202,729 H39Y possibly damaging Het
Capn13 C A 17: 73,315,305 M663I probably damaging Het
Clec2g A G 6: 128,979,437 E72G probably damaging Het
Col12a1 T A 9: 79,651,486 Y1899F probably damaging Het
Ctbp2 A G 7: 133,014,624 V194A probably benign Het
Cttnbp2 G T 6: 18,382,810 L1320I probably damaging Het
E2f2 T A 4: 136,192,826 L374* probably null Het
Echdc3 C T 2: 6,212,876 G29S probably benign Het
Ecm1 A G 3: 95,736,182 S269P probably damaging Het
Elmo2 G A 2: 165,291,744 P775S unknown Het
Eno3 T A 11: 70,659,167 probably null Het
Faf1 G A 4: 109,829,864 R267K probably benign Het
Fam162a G A 16: 36,049,937 probably benign Het
Fam178b T A 1: 36,564,451 D473V probably damaging Het
Fat2 G A 11: 55,282,330 T2519I probably damaging Het
Foxc2 A G 8: 121,118,095 Y494C probably damaging Het
Gcnt2 C A 13: 40,953,719 Q355K probably benign Het
Glg1 G T 8: 111,178,865 H595N probably benign Het
Gm9913 A T 2: 125,506,560 H97L unknown Het
Hbegf T A 18: 36,507,548 N152I possibly damaging Het
Hipk1 G A 3: 103,760,550 T567I probably damaging Het
Idh3a C T 9: 54,595,169 P78S probably damaging Het
Igsf10 A T 3: 59,319,340 M2304K possibly damaging Het
Itpr2 A T 6: 146,187,550 F2220Y probably benign Het
Kpnb1 C T 11: 97,169,173 R557Q probably damaging Het
Lefty1 A G 1: 180,936,760 D155G probably damaging Het
Lrp1 A G 10: 127,574,053 C1554R probably damaging Het
Lrrc10 A G 10: 117,045,757 D112G probably benign Het
Med12l A G 3: 59,076,720 E439G probably damaging Het
Ms4a7 A T 19: 11,324,504 F185Y probably benign Het
Mtmr6 T A 14: 60,289,652 M234K probably damaging Het
Myh7b C A 2: 155,617,778 probably null Het
Myo1d T C 11: 80,676,893 M254V possibly damaging Het
Nbas T C 12: 13,415,661 V1368A probably damaging Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Neb A G 2: 52,206,702 V4999A probably damaging Het
Npbwr1 G T 1: 5,916,708 Q196K probably benign Het
Nsd3 A T 8: 25,659,817 E339D possibly damaging Het
Olfr738 T C 14: 50,414,014 F157L probably damaging Het
Olfr776 A G 10: 129,261,068 S36G probably damaging Het
Olfr867 T C 9: 20,054,605 N168S probably damaging Het
Oog4 CAA CA 4: 143,437,452 probably null Het
Plxna1 C T 6: 89,331,900 V1199M probably damaging Het
Ppfibp2 T A 7: 107,716,666 M285K probably damaging Het
Ppip5k1 A G 2: 121,337,661 Y704H probably damaging Het
Ptpn18 G A 1: 34,473,364 D417N possibly damaging Het
Sbspon T C 1: 15,859,058 M170V probably benign Het
Scfd2 A C 5: 74,458,636 F440V probably benign Het
Slc22a19 T A 19: 7,710,937 D86V possibly damaging Het
Smg5 A G 3: 88,353,895 N685S possibly damaging Het
Spata46 A G 1: 170,311,764 R111G possibly damaging Het
Sry A T Y: 2,663,248 D137E possibly damaging Het
Tbkbp1 T C 11: 97,149,483 D35G probably damaging Het
Tcf20 A T 15: 82,851,565 V1895D possibly damaging Het
Tfap4 G T 16: 4,551,766 Q112K possibly damaging Het
Tmem2 C A 19: 21,798,116 T241K probably damaging Het
Trmt10c T A 16: 56,034,939 D111V probably benign Het
Unc80 T C 1: 66,649,722 I2415T probably benign Het
Vmn2r107 A T 17: 20,356,639 M300L probably benign Het
Vmn2r5 A T 3: 64,509,522 F72I probably benign Het
Vmn2r53 T A 7: 12,598,498 H408L probably benign Het
Zan C T 5: 137,463,540 V1126M unknown Het
Zfp493 A T 13: 67,779,695 probably benign Het
Zfp618 C A 4: 63,086,621 A86E probably benign Het
Other mutations in Inf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Inf2 APN 12 112611856 nonsense probably null
IGL01582:Inf2 APN 12 112610559 missense unknown
IGL02078:Inf2 APN 12 112601614 missense probably damaging 1.00
IGL02534:Inf2 APN 12 112610496 missense unknown
IGL03122:Inf2 APN 12 112604229 missense probably benign 0.03
IGL03296:Inf2 APN 12 112604208 nonsense probably null
Talon UTSW 12 112610287 splice site probably benign
R0413:Inf2 UTSW 12 112601676 missense probably damaging 1.00
R0552:Inf2 UTSW 12 112612574 intron probably benign
R0920:Inf2 UTSW 12 112610287 splice site probably benign
R1240:Inf2 UTSW 12 112610776 missense unknown
R1452:Inf2 UTSW 12 112601344 missense probably damaging 0.99
R1974:Inf2 UTSW 12 112608337 missense unknown
R2422:Inf2 UTSW 12 112610824 missense unknown
R3877:Inf2 UTSW 12 112610830 missense unknown
R4108:Inf2 UTSW 12 112607581 missense unknown
R4490:Inf2 UTSW 12 112600204 missense probably damaging 1.00
R5071:Inf2 UTSW 12 112612039 splice site probably null
R5074:Inf2 UTSW 12 112612039 splice site probably null
R5306:Inf2 UTSW 12 112601553 missense probably benign 0.26
R5383:Inf2 UTSW 12 112600145 missense probably damaging 0.99
R5569:Inf2 UTSW 12 112601679 missense possibly damaging 0.80
R5664:Inf2 UTSW 12 112611728 missense unknown
R6157:Inf2 UTSW 12 112604788 unclassified probably benign
R6221:Inf2 UTSW 12 112603745 missense possibly damaging 0.66
R6429:Inf2 UTSW 12 112604256 missense probably benign 0.01
R6955:Inf2 UTSW 12 112610731 missense unknown
R7423:Inf2 UTSW 12 112609738 missense unknown
R7444:Inf2 UTSW 12 112605387 missense unknown
R7496:Inf2 UTSW 12 112600318 missense probably damaging 1.00
R7605:Inf2 UTSW 12 112601337 missense probably damaging 1.00
R7708:Inf2 UTSW 12 112607557 missense unknown
R7752:Inf2 UTSW 12 112609684 missense unknown
R7903:Inf2 UTSW 12 112612554 missense unknown
R8024:Inf2 UTSW 12 112608902 missense unknown
R8118:Inf2 UTSW 12 112601437 missense probably damaging 0.99
R8139:Inf2 UTSW 12 112601640 nonsense probably null
R8229:Inf2 UTSW 12 112611596 missense unknown
R8299:Inf2 UTSW 12 112604112 missense probably benign 0.00
R8918:Inf2 UTSW 12 112606269 missense unknown
R8955:Inf2 UTSW 12 112610564 missense unknown
R8973:Inf2 UTSW 12 112607515 missense unknown
Predicted Primers PCR Primer
(F):5'- GGATAGCAAAGGCCTGACCC -3'
(R):5'- AGAGACAGCTGCCTTCCTG -3'

Sequencing Primer
(F):5'- AGACCCAAGGCTGGAGC -3'
(R):5'- AGCTGCCTTCCTGCCCTG -3'
Posted On2019-11-12