Mutagenetix > Incidental Mutation

Incidental Mutation 'R7678:Gcnt2'

592599

Institutional Source

Beutler Lab

Gene Symbol

Gcnt2

Ensembl Gene

ENSMUSG00000021360

Gene Name

glucosaminyl (N-acetyl) transferase 2, I-branching enzyme

Synonyms

IGnTB, IGnT, IGnTA, IGnTC, 5330430K10Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.083) question?

Stock #

R7678 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

40859754-40960892 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 40953719 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Lysine at position 355 (Q355K)

Ref Sequence

ENSEMBL: ENSMUSP00000153207 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000067778] [ENSMUST00000069958] [ENSMUST00000110191] [ENSMUST00000223570] [ENSMUST00000225759]

AlphaFold

P97402

Predicted Effect

probably benign
Transcript: ENSMUST00000067778

SMART Domains

Protein: ENSMUSP00000066467
Gene: ENSMUSG00000021360

Domain	Start	End	E-Value	Type
transmembrane domain	7	26	N/A	INTRINSIC
Pfam:Branch	95	357	4.2e-58	PFAM
low complexity region	377	386	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000069958

SMART Domains

Protein: ENSMUSP00000070942
Gene: ENSMUSG00000021360

Domain	Start	End	E-Value	Type
low complexity region	8	21	N/A	INTRINSIC
Pfam:Branch	95	357	8.4e-60	PFAM
low complexity region	377	386	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000110191

SMART Domains

Protein: ENSMUSP00000105820
Gene: ENSMUSG00000021360

Domain	Start	End	E-Value	Type
transmembrane domain	7	24	N/A	INTRINSIC
Pfam:Branch	95	357	5.2e-61	PFAM
low complexity region	377	386	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000223570
AA Change: Q44K

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)

Predicted Effect

probably benign
Transcript: ENSMUST00000225759
AA Change: Q355K

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)

Meta Mutation Damage Score

0.0846

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

99% (67/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the enzyme responsible for formation of the blood group I antigen. The i and I antigens are distinguished by linear and branched poly-N-acetyllactosaminoglycans, respectively. The encoded protein is the I-branching enzyme, a beta-1,6-N-acetylglucosaminyltransferase responsible for the conversion of fetal i antigen to adult I antigen in erythrocytes during embryonic development. Mutations in this gene have been associated with adult i blood group phenotype. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show hypoactivity, a reduced B cell number, epidermoid cyst formation in male abdominal skin, and impaired renal function with increased blood urea nitrogen and creatinine levels and vacuolization of renal tubular epithelial cells in aging mice. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam22	C	A	5: 8,087,750		probably null	Het
Ank1	A	G	8: 23,117,058	D1325G	probably damaging	Het
Asxl1	T	C	2: 153,400,652	S1042P	probably damaging	Het
Bpifb1	C	T	2: 154,202,729	H39Y	possibly damaging	Het
Capn13	C	A	17: 73,315,305	M663I	probably damaging	Het
Clec2g	A	G	6: 128,979,437	E72G	probably damaging	Het
Col12a1	T	A	9: 79,651,486	Y1899F	probably damaging	Het
Ctbp2	A	G	7: 133,014,624	V194A	probably benign	Het
Cttnbp2	G	T	6: 18,382,810	L1320I	probably damaging	Het
E2f2	T	A	4: 136,192,826	L374*	probably null	Het
Echdc3	C	T	2: 6,212,876	G29S	probably benign	Het
Ecm1	A	G	3: 95,736,182	S269P	probably damaging	Het
Elmo2	G	A	2: 165,291,744	P775S	unknown	Het
Eno3	T	A	11: 70,659,167		probably null	Het
Faf1	G	A	4: 109,829,864	R267K	probably benign	Het
Fam162a	G	A	16: 36,049,937		probably benign	Het
Fam178b	T	A	1: 36,564,451	D473V	probably damaging	Het
Fat2	G	A	11: 55,282,330	T2519I	probably damaging	Het
Foxc2	A	G	8: 121,118,095	Y494C	probably damaging	Het
Glg1	G	T	8: 111,178,865	H595N	probably benign	Het
Gm9913	A	T	2: 125,506,560	H97L	unknown	Het
Hbegf	T	A	18: 36,507,548	N152I	possibly damaging	Het
Hipk1	G	A	3: 103,760,550	T567I	probably damaging	Het
Idh3a	C	T	9: 54,595,169	P78S	probably damaging	Het
Igsf10	A	T	3: 59,319,340	M2304K	possibly damaging	Het
Inf2	A	G	12: 112,606,994	T723A	unknown	Het
Itpr2	A	T	6: 146,187,550	F2220Y	probably benign	Het
Kpnb1	C	T	11: 97,169,173	R557Q	probably damaging	Het
Lefty1	A	G	1: 180,936,760	D155G	probably damaging	Het
Lrp1	A	G	10: 127,574,053	C1554R	probably damaging	Het
Lrrc10	A	G	10: 117,045,757	D112G	probably benign	Het
Med12l	A	G	3: 59,076,720	E439G	probably damaging	Het
Ms4a7	A	T	19: 11,324,504	F185Y	probably benign	Het
Mtmr6	T	A	14: 60,289,652	M234K	probably damaging	Het
Myh7b	C	A	2: 155,617,778		probably null	Het
Myo1d	T	C	11: 80,676,893	M254V	possibly damaging	Het
Nbas	T	C	12: 13,415,661	V1368A	probably damaging	Het
Nbeal1	G	C	1: 60,237,151	V684L	probably benign	Het
Neb	A	G	2: 52,206,702	V4999A	probably damaging	Het
Npbwr1	G	T	1: 5,916,708	Q196K	probably benign	Het
Nsd3	A	T	8: 25,659,817	E339D	possibly damaging	Het
Olfr738	T	C	14: 50,414,014	F157L	probably damaging	Het
Olfr776	A	G	10: 129,261,068	S36G	probably damaging	Het
Olfr867	T	C	9: 20,054,605	N168S	probably damaging	Het
Oog4	CAA	CA	4: 143,437,452		probably null	Het
Plxna1	C	T	6: 89,331,900	V1199M	probably damaging	Het
Ppfibp2	T	A	7: 107,716,666	M285K	probably damaging	Het
Ppip5k1	A	G	2: 121,337,661	Y704H	probably damaging	Het
Ptpn18	G	A	1: 34,473,364	D417N	possibly damaging	Het
Sbspon	T	C	1: 15,859,058	M170V	probably benign	Het
Scfd2	A	C	5: 74,458,636	F440V	probably benign	Het
Slc22a19	T	A	19: 7,710,937	D86V	possibly damaging	Het
Smg5	A	G	3: 88,353,895	N685S	possibly damaging	Het
Spata46	A	G	1: 170,311,764	R111G	possibly damaging	Het
Sry	A	T	Y: 2,663,248	D137E	possibly damaging	Het
Tbkbp1	T	C	11: 97,149,483	D35G	probably damaging	Het
Tcf20	A	T	15: 82,851,565	V1895D	possibly damaging	Het
Tfap4	G	T	16: 4,551,766	Q112K	possibly damaging	Het
Tmem2	C	A	19: 21,798,116	T241K	probably damaging	Het
Trmt10c	T	A	16: 56,034,939	D111V	probably benign	Het
Unc80	T	C	1: 66,649,722	I2415T	probably benign	Het
Vmn2r107	A	T	17: 20,356,639	M300L	probably benign	Het
Vmn2r5	A	T	3: 64,509,522	F72I	probably benign	Het
Vmn2r53	T	A	7: 12,598,498	H408L	probably benign	Het
Zan	C	T	5: 137,463,540	V1126M	unknown	Het
Zfp493	A	T	13: 67,779,695		probably benign	Het
Zfp618	C	A	4: 63,086,621	A86E	probably benign	Het

Other mutations in Gcnt2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01523:Gcnt2	APN	13	40887863	missense	probably benign	0.06
IGL01693:Gcnt2	APN	13	40888073	missense	probably benign
IGL02506:Gcnt2	APN	13	40887380	missense	probably benign	0.02
IGL03184:Gcnt2	APN	13	40888184	missense	probably benign	0.01
BB001:Gcnt2	UTSW	13	40918564	nonsense	probably null
BB011:Gcnt2	UTSW	13	40918564	nonsense	probably null
PIT4472001:Gcnt2	UTSW	13	40917937	missense	probably benign	0.39
R0358:Gcnt2	UTSW	13	40860853	missense	probably damaging	0.99
R0734:Gcnt2	UTSW	13	40860521	missense	probably benign	0.00
R1863:Gcnt2	UTSW	13	40861101	missense	possibly damaging	0.95
R3103:Gcnt2	UTSW	13	40918606	missense	probably benign	0.00
R3156:Gcnt2	UTSW	13	40861178	missense	probably benign	0.36
R3893:Gcnt2	UTSW	13	40860446	missense	probably benign	0.14
R4134:Gcnt2	UTSW	13	40887807	missense	probably damaging	1.00
R4135:Gcnt2	UTSW	13	40887807	missense	probably damaging	1.00
R4279:Gcnt2	UTSW	13	40888190	missense	probably benign	0.17
R4422:Gcnt2	UTSW	13	40860525	nonsense	probably null
R4599:Gcnt2	UTSW	13	40887490	missense	probably benign
R4618:Gcnt2	UTSW	13	40958194	nonsense	probably null
R4908:Gcnt2	UTSW	13	40860734	missense	probably damaging	1.00
R5123:Gcnt2	UTSW	13	40918355	missense	probably damaging	0.99
R5291:Gcnt2	UTSW	13	40918792	missense	probably damaging	1.00
R5437:Gcnt2	UTSW	13	40861176	missense	probably damaging	1.00
R5463:Gcnt2	UTSW	13	40918174	missense	possibly damaging	0.80
R5471:Gcnt2	UTSW	13	40860719	missense	probably damaging	1.00
R5472:Gcnt2	UTSW	13	40953579	missense	probably benign	0.30
R5493:Gcnt2	UTSW	13	40953600	missense	possibly damaging	0.70
R5586:Gcnt2	UTSW	13	40860953	missense	probably damaging	1.00
R5695:Gcnt2	UTSW	13	40918199	missense	probably benign	0.03
R6244:Gcnt2	UTSW	13	40861241	missense	probably damaging	1.00
R6293:Gcnt2	UTSW	13	40918697	missense	probably damaging	1.00
R7036:Gcnt2	UTSW	13	40887556	frame shift	probably null
R7077:Gcnt2	UTSW	13	40860420	missense	probably benign
R7432:Gcnt2	UTSW	13	40887212	intron	probably benign
R7474:Gcnt2	UTSW	13	40958257	missense	probably damaging	1.00
R7508:Gcnt2	UTSW	13	40887681	missense	probably benign	0.02
R7599:Gcnt2	UTSW	13	40860867	nonsense	probably null
R7806:Gcnt2	UTSW	13	40918241	missense	probably damaging	1.00
R7808:Gcnt2	UTSW	13	40860862	missense	possibly damaging	0.81
R7909:Gcnt2	UTSW	13	40860450	missense	probably benign	0.00
R7924:Gcnt2	UTSW	13	40918564	nonsense	probably null
R8110:Gcnt2	UTSW	13	40917722	start gained	probably benign
R8287:Gcnt2	UTSW	13	40860632	missense	probably damaging	1.00
R8782:Gcnt2	UTSW	13	40918753	missense	probably damaging	0.98
R8956:Gcnt2	UTSW	13	40887728	missense	probably benign	0.30
R9225:Gcnt2	UTSW	13	40860860	missense	probably damaging	1.00
R9357:Gcnt2	UTSW	13	40888256	missense	possibly damaging	0.92
Z1088:Gcnt2	UTSW	13	40918639	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTTAGTGCAATGTCGTCATCG -3'
(R):5'- TGCACTCCCAGAAGGAAAGG -3'

Sequencing Primer
(F):5'- CAATGTCGTCATCGTTACAGGAGTC -3'
(R):5'- GAGAGCAGAAATTAGCATCTCTCTC -3'

Posted On

2019-11-12