Incidental Mutation 'R7678:Olfr738'
ID592601
Institutional Source Beutler Lab
Gene Symbol Olfr738
Ensembl Gene ENSMUSG00000094692
Gene Nameolfactory receptor 738
SynonymsGA_x6K02T2PMLR-6110726-6111661, MOR106-3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R7678 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location50407568-50415438 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 50414014 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 157 (F157L)
Ref Sequence ENSEMBL: ENSMUSP00000150067 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058972] [ENSMUST00000214320] [ENSMUST00000214853] [ENSMUST00000216949]
Predicted Effect probably damaging
Transcript: ENSMUST00000058972
AA Change: F157L

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000059540
Gene: ENSMUSG00000094692
AA Change: F157L

DomainStartEndE-ValueType
Pfam:7tm_4 35 311 2.5e-50 PFAM
Pfam:7TM_GPCR_Srsx 39 309 1.3e-5 PFAM
Pfam:7tm_1 45 294 6.9e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214320
AA Change: F157L

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000214853
AA Change: F157L

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000216949
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam22 C A 5: 8,087,750 probably null Het
Ank1 A G 8: 23,117,058 D1325G probably damaging Het
Asxl1 T C 2: 153,400,652 S1042P probably damaging Het
Bpifb1 C T 2: 154,202,729 H39Y possibly damaging Het
Capn13 C A 17: 73,315,305 M663I probably damaging Het
Clec2g A G 6: 128,979,437 E72G probably damaging Het
Col12a1 T A 9: 79,651,486 Y1899F probably damaging Het
Ctbp2 A G 7: 133,014,624 V194A probably benign Het
Cttnbp2 G T 6: 18,382,810 L1320I probably damaging Het
E2f2 T A 4: 136,192,826 L374* probably null Het
Echdc3 C T 2: 6,212,876 G29S probably benign Het
Ecm1 A G 3: 95,736,182 S269P probably damaging Het
Elmo2 G A 2: 165,291,744 P775S unknown Het
Eno3 T A 11: 70,659,167 probably null Het
Faf1 G A 4: 109,829,864 R267K probably benign Het
Fam162a G A 16: 36,049,937 probably benign Het
Fam178b T A 1: 36,564,451 D473V probably damaging Het
Fat2 G A 11: 55,282,330 T2519I probably damaging Het
Foxc2 A G 8: 121,118,095 Y494C probably damaging Het
Gcnt2 C A 13: 40,953,719 Q355K probably benign Het
Glg1 G T 8: 111,178,865 H595N probably benign Het
Gm9913 A T 2: 125,506,560 H97L unknown Het
Hbegf T A 18: 36,507,548 N152I possibly damaging Het
Hipk1 G A 3: 103,760,550 T567I probably damaging Het
Idh3a C T 9: 54,595,169 P78S probably damaging Het
Igsf10 A T 3: 59,319,340 M2304K possibly damaging Het
Inf2 A G 12: 112,606,994 T723A unknown Het
Itpr2 A T 6: 146,187,550 F2220Y probably benign Het
Kpnb1 C T 11: 97,169,173 R557Q probably damaging Het
Lefty1 A G 1: 180,936,760 D155G probably damaging Het
Lrp1 A G 10: 127,574,053 C1554R probably damaging Het
Lrrc10 A G 10: 117,045,757 D112G probably benign Het
Med12l A G 3: 59,076,720 E439G probably damaging Het
Ms4a7 A T 19: 11,324,504 F185Y probably benign Het
Mtmr6 T A 14: 60,289,652 M234K probably damaging Het
Myh7b C A 2: 155,617,778 probably null Het
Myo1d T C 11: 80,676,893 M254V possibly damaging Het
Nbas T C 12: 13,415,661 V1368A probably damaging Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Neb A G 2: 52,206,702 V4999A probably damaging Het
Npbwr1 G T 1: 5,916,708 Q196K probably benign Het
Nsd3 A T 8: 25,659,817 E339D possibly damaging Het
Olfr776 A G 10: 129,261,068 S36G probably damaging Het
Olfr867 T C 9: 20,054,605 N168S probably damaging Het
Oog4 CAA CA 4: 143,437,452 probably null Het
Plxna1 C T 6: 89,331,900 V1199M probably damaging Het
Ppfibp2 T A 7: 107,716,666 M285K probably damaging Het
Ppip5k1 A G 2: 121,337,661 Y704H probably damaging Het
Ptpn18 G A 1: 34,473,364 D417N possibly damaging Het
Sbspon T C 1: 15,859,058 M170V probably benign Het
Scfd2 A C 5: 74,458,636 F440V probably benign Het
Slc22a19 T A 19: 7,710,937 D86V possibly damaging Het
Smg5 A G 3: 88,353,895 N685S possibly damaging Het
Spata46 A G 1: 170,311,764 R111G possibly damaging Het
Sry A T Y: 2,663,248 D137E possibly damaging Het
Tbkbp1 T C 11: 97,149,483 D35G probably damaging Het
Tcf20 A T 15: 82,851,565 V1895D possibly damaging Het
Tfap4 G T 16: 4,551,766 Q112K possibly damaging Het
Tmem2 C A 19: 21,798,116 T241K probably damaging Het
Trmt10c T A 16: 56,034,939 D111V probably benign Het
Unc80 T C 1: 66,649,722 I2415T probably benign Het
Vmn2r107 A T 17: 20,356,639 M300L probably benign Het
Vmn2r5 A T 3: 64,509,522 F72I probably benign Het
Vmn2r53 T A 7: 12,598,498 H408L probably benign Het
Zan C T 5: 137,463,540 V1126M unknown Het
Zfp493 A T 13: 67,779,695 probably benign Het
Zfp618 C A 4: 63,086,621 A86E probably benign Het
Other mutations in Olfr738
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01608:Olfr738 APN 14 50414453 missense probably benign
IGL01935:Olfr738 APN 14 50413555 missense probably benign
IGL02431:Olfr738 APN 14 50413769 missense probably damaging 1.00
BB008:Olfr738 UTSW 14 50414329 missense probably damaging 0.96
BB018:Olfr738 UTSW 14 50414329 missense probably damaging 0.96
PIT4480001:Olfr738 UTSW 14 50413915 missense probably benign 0.14
R0620:Olfr738 UTSW 14 50413697 missense probably benign 0.20
R1445:Olfr738 UTSW 14 50414401 missense probably damaging 1.00
R1831:Olfr738 UTSW 14 50414201 splice site probably null
R1915:Olfr738 UTSW 14 50414341 missense probably damaging 1.00
R4748:Olfr738 UTSW 14 50413876 missense possibly damaging 0.77
R5301:Olfr738 UTSW 14 50413573 missense probably benign 0.09
R5767:Olfr738 UTSW 14 50413778 missense possibly damaging 0.55
R5831:Olfr738 UTSW 14 50413982 splice site probably null
R6173:Olfr738 UTSW 14 50414197 missense possibly damaging 0.70
R6176:Olfr738 UTSW 14 50414390 missense probably damaging 1.00
R7356:Olfr738 UTSW 14 50413702 missense probably damaging 1.00
R7931:Olfr738 UTSW 14 50414329 missense probably damaging 0.96
R8508:Olfr738 UTSW 14 50413675 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CGAAGGTCATCTCTTTCTCTGG -3'
(R):5'- CTGAGCACAGCCCTCATTAC -3'

Sequencing Primer
(F):5'- AGGTCATCTCTTTCTCTGGATGCTTC -3'
(R):5'- TGAGCACAGCCCTCATTACTAGAG -3'
Posted On2019-11-12