Incidental Mutation 'R7678:Tfap4'
ID592604
Institutional Source Beutler Lab
Gene Symbol Tfap4
Ensembl Gene ENSMUSG00000005718
Gene Nametranscription factor AP4
SynonymsAP-4, bHLHc41, Tcfap4
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.730) question?
Stock #R7678 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location4544661-4559854 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 4551766 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 112 (Q112K)
Ref Sequence ENSEMBL: ENSMUSP00000005862 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005862] [ENSMUST00000229956] [ENSMUST00000230875]
Predicted Effect possibly damaging
Transcript: ENSMUST00000005862
AA Change: Q112K

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000005862
Gene: ENSMUSG00000005718
AA Change: Q112K

DomainStartEndE-ValueType
low complexity region 41 52 N/A INTRINSIC
HLH 54 105 2.06e-16 SMART
coiled coil region 144 183 N/A INTRINSIC
low complexity region 193 210 N/A INTRINSIC
low complexity region 225 238 N/A INTRINSIC
low complexity region 306 327 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000229956
AA Change: Q92K

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect possibly damaging
Transcript: ENSMUST00000230875
AA Change: Q52K

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Transcription factors of the basic helix-loop-helix-zipper (bHLH-ZIP) family contain a basic domain, which is used for DNA binding, and HLH and ZIP domains, which are used for oligomerization. Transcription factor AP4 activates both viral and cellular genes by binding to the symmetrical DNA sequence CAGCTG (Mermod et al., 1988 [PubMed 2833704]; Hu et al., 1990 [PubMed 2123466]).[supplied by OMIM, Jul 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial prenatal lethality and reduced suppression of Cd4 in double negative thymocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam22 C A 5: 8,087,750 probably null Het
Ank1 A G 8: 23,117,058 D1325G probably damaging Het
Asxl1 T C 2: 153,400,652 S1042P probably damaging Het
Bpifb1 C T 2: 154,202,729 H39Y possibly damaging Het
Capn13 C A 17: 73,315,305 M663I probably damaging Het
Clec2g A G 6: 128,979,437 E72G probably damaging Het
Col12a1 T A 9: 79,651,486 Y1899F probably damaging Het
Ctbp2 A G 7: 133,014,624 V194A probably benign Het
Cttnbp2 G T 6: 18,382,810 L1320I probably damaging Het
E2f2 T A 4: 136,192,826 L374* probably null Het
Echdc3 C T 2: 6,212,876 G29S probably benign Het
Ecm1 A G 3: 95,736,182 S269P probably damaging Het
Elmo2 G A 2: 165,291,744 P775S unknown Het
Eno3 T A 11: 70,659,167 probably null Het
Faf1 G A 4: 109,829,864 R267K probably benign Het
Fam162a G A 16: 36,049,937 probably benign Het
Fam178b T A 1: 36,564,451 D473V probably damaging Het
Fat2 G A 11: 55,282,330 T2519I probably damaging Het
Foxc2 A G 8: 121,118,095 Y494C probably damaging Het
Gcnt2 C A 13: 40,953,719 Q355K probably benign Het
Glg1 G T 8: 111,178,865 H595N probably benign Het
Gm9913 A T 2: 125,506,560 H97L unknown Het
Hbegf T A 18: 36,507,548 N152I possibly damaging Het
Hipk1 G A 3: 103,760,550 T567I probably damaging Het
Idh3a C T 9: 54,595,169 P78S probably damaging Het
Igsf10 A T 3: 59,319,340 M2304K possibly damaging Het
Inf2 A G 12: 112,606,994 T723A unknown Het
Itpr2 A T 6: 146,187,550 F2220Y probably benign Het
Kpnb1 C T 11: 97,169,173 R557Q probably damaging Het
Lefty1 A G 1: 180,936,760 D155G probably damaging Het
Lrp1 A G 10: 127,574,053 C1554R probably damaging Het
Lrrc10 A G 10: 117,045,757 D112G probably benign Het
Med12l A G 3: 59,076,720 E439G probably damaging Het
Ms4a7 A T 19: 11,324,504 F185Y probably benign Het
Mtmr6 T A 14: 60,289,652 M234K probably damaging Het
Myh7b C A 2: 155,617,778 probably null Het
Myo1d T C 11: 80,676,893 M254V possibly damaging Het
Nbas T C 12: 13,415,661 V1368A probably damaging Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Neb A G 2: 52,206,702 V4999A probably damaging Het
Npbwr1 G T 1: 5,916,708 Q196K probably benign Het
Nsd3 A T 8: 25,659,817 E339D possibly damaging Het
Olfr738 T C 14: 50,414,014 F157L probably damaging Het
Olfr776 A G 10: 129,261,068 S36G probably damaging Het
Olfr867 T C 9: 20,054,605 N168S probably damaging Het
Oog4 CAA CA 4: 143,437,452 probably null Het
Plxna1 C T 6: 89,331,900 V1199M probably damaging Het
Ppfibp2 T A 7: 107,716,666 M285K probably damaging Het
Ppip5k1 A G 2: 121,337,661 Y704H probably damaging Het
Ptpn18 G A 1: 34,473,364 D417N possibly damaging Het
Sbspon T C 1: 15,859,058 M170V probably benign Het
Scfd2 A C 5: 74,458,636 F440V probably benign Het
Slc22a19 T A 19: 7,710,937 D86V possibly damaging Het
Smg5 A G 3: 88,353,895 N685S possibly damaging Het
Spata46 A G 1: 170,311,764 R111G possibly damaging Het
Sry A T Y: 2,663,248 D137E possibly damaging Het
Tbkbp1 T C 11: 97,149,483 D35G probably damaging Het
Tcf20 A T 15: 82,851,565 V1895D possibly damaging Het
Tmem2 C A 19: 21,798,116 T241K probably damaging Het
Trmt10c T A 16: 56,034,939 D111V probably benign Het
Unc80 T C 1: 66,649,722 I2415T probably benign Het
Vmn2r107 A T 17: 20,356,639 M300L probably benign Het
Vmn2r5 A T 3: 64,509,522 F72I probably benign Het
Vmn2r53 T A 7: 12,598,498 H408L probably benign Het
Zan C T 5: 137,463,540 V1126M unknown Het
Zfp493 A T 13: 67,779,695 probably benign Het
Zfp618 C A 4: 63,086,621 A86E probably benign Het
Other mutations in Tfap4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01155:Tfap4 APN 16 4547359 missense probably damaging 1.00
IGL01816:Tfap4 APN 16 4552092 missense probably damaging 0.98
IGL02947:Tfap4 APN 16 4551360 missense probably damaging 0.99
E0370:Tfap4 UTSW 16 4559470 missense possibly damaging 0.53
R1311:Tfap4 UTSW 16 4559426 critical splice donor site probably null
R1791:Tfap4 UTSW 16 4552069 missense possibly damaging 0.53
R4300:Tfap4 UTSW 16 4551360 missense probably damaging 0.99
R4371:Tfap4 UTSW 16 4551999 missense probably damaging 1.00
R5945:Tfap4 UTSW 16 4545629 missense possibly damaging 0.53
R6219:Tfap4 UTSW 16 4547311 missense probably damaging 0.96
R6738:Tfap4 UTSW 16 4549447 missense probably damaging 0.99
X0065:Tfap4 UTSW 16 4547276 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- GTGGAAGAATGGCCTTACGTTC -3'
(R):5'- CCACACAGATGGAGAGAAGCTC -3'

Sequencing Primer
(F):5'- TGGCCTTACGTTCTAGAACAGAGC -3'
(R):5'- GCTCAGCAAGGTGGCAG -3'
Posted On2019-11-12